Author: Kenneth N. Hass; Mengdi Bao; Qian He; Myeongkee Park; Peiwu Qin; Ke Du
Title: Integrated Micropillar Polydimethylsiloxane Accurate CRISPR Detection (IMPACT) System for Rapid Viral DNA Sensing Document date: 2020_3_20
ID: d840uu3e_5
Snippet: After establishing a surface modification and streptavidin incubation strategy, we first determined the channel washing conditions. After incubating biotinylated photocleavable capture probes (/5PCBio/TTATTCTTATTGTGTGAACTGCTCCTTC TTGACTCCACC/36-FAM/) in the channel for 3 hrs, the channel was washed with 75 μL DI water. Then, the channel was evacuated, and the fluorescence intensity of the supernatant was immediately evaluated. After the first wa.....
Document: After establishing a surface modification and streptavidin incubation strategy, we first determined the channel washing conditions. After incubating biotinylated photocleavable capture probes (/5PCBio/TTATTCTTATTGTGTGAACTGCTCCTTC TTGACTCCACC/36-FAM/) in the channel for 3 hrs, the channel was washed with 75 μL DI water. Then, the channel was evacuated, and the fluorescence intensity of the supernatant was immediately evaluated. After the first wash, a high fluorescence peak was observed for all the samples (inset of Fig. 2a) , indicating that excessive DNA probes were washed from the channel. A second wash was performed to confirm the unbounded DNA probes were completely removed from the channel. After the second wash, the collected supernatant barely shows any fluorescence peak. As shown in Fig. 2a , the integrated signal (490 to 700 nm) for the first supernatant ranges between ~8,000 to 9,000 counts, regardless of surface treatment conditions (Saturated the spectrometer due to high signal). On the other hand, the integrated signal for the second supernatant is only ~300 counts, eliminating the background caused by weakly bounded DNA probes. After washing, the bounded reporter probe was released by UV exposure and the results are presented in Fig. 2b . The flat channel coated with streptavidin shows ~3 fold more reporter probe binding than the uncoated surface. In addition, the micropillar channel coated with streptavidin shows the highest signal among the three substrates.
Search related documents:
Co phrase search for related documents- capture probe and dna probe: 1, 2, 3, 4, 5, 6, 7, 8, 9
- channel washing and di water: 1
Co phrase search for related documents, hyperlinks ordered by date