Author: Ze Chen; Xiaofeng Xu; Xiaojun Yang; Weihao Dou; Xiufeng Jin; Haishuo Ji; Guangyuan Liu; Jianxun Luo; Hong Yin; Gao Shan
Title: DNA segment of African Swine Fever Virus first detected in hard ticks from sheep and bovine Document date: 2018_12_3
ID: 36rq4rmg_12
Snippet: using the protocol published in our previous study [15] . PCR amplification of DNA and cDNA using ASFV 146 specific primers GCAGAACTTTGATGGAAACTTA and TCCTCATCAACACCGAGATTGGCAC to 147 produce a 235-bp DNA segment ( Figure 1B).....
Document: using the protocol published in our previous study [15] . PCR amplification of DNA and cDNA using ASFV 146 specific primers GCAGAACTTTGATGGAAACTTA and TCCTCATCAACACCGAGATTGGCAC to 147 produce a 235-bp DNA segment ( Figure 1B)
Search related documents:
Co phrase search for related documents- cdna dna and PCR amplification: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
- cdna dna and previous study: 1
- cdna dna PCR amplification and PCR amplification: 1
- dna segment and PCR amplification: 1
Co phrase search for related documents, hyperlinks ordered by date