Selected article for: "new pathogen detection and pathogen detection"

Author: Liu, Chang; Chen, Ze; Shen, Wenyuan; Yu, Deshui; Li, Siyu; Hu, Yue; Ji, Haishuo; Bu, Wenjun; Wang, Qingsong; Gao, Shan
Title: Complemented palindrome small RNAs first discovered from SARS coronavirus
  • Cord-id: g55d5ijx
  • Document date: 2017_12_13
  • ID: g55d5ijx
    Snippet: In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments s
    Document: In this study, we reported for the first time the existence of complemented palindrome small RNAs (cpsRNAs) and proposed cpsRNAs and palindrome small RNAs (psRNAs) as a novel class of small RNAs. The first discovered cpsRNA UCUUUAACAAGCUUGUUAAAGA from SARS coronavirus named SARS-CoV-cpsR-22 contained 22 nucleotides perfectly matching its reverse complementary sequence. Further sequence analysis supported that SARS-CoV-cpsR-22 originated from bat betacoronavirus. The results of RNAi experiments showed that one 19-nt segment of SARS-CoV-cpsR-22 significantly induced cell apoptosis. These results suggested that SARS-CoV-cpsR-22 could play a role in SARS-CoV infection or pathogenicity. The discovery of psRNAs and cpsRNAs paved the way to find new markers for pathogen detection and reveal the mechanisms in the infection or pathogenicity from a different point of view. The discovery of psRNAs and cpsRNAs also broaden the understanding of palindrome motifs in animal of plant genomes.

    Search related documents:
    Co phrase search for related documents
    • Try single phrases listed below for: 1
    Co phrase search for related documents, hyperlinks ordered by date