Selected article for: "adapter sequence and nt sequence"
Author: Ian M. Silverman; Sager J. Gosai; Nicholas Vrettos; Shawn W. Foley; Nathan D. Berkowitz; Zissimos Mourelatos; Brian D. Gregory
Title: Isolation and sequencing of AGO-bound RNAs reveals characteristics of mammalian stem-loop processing in vivo
  • Document date: 2018_4_6
    • ID: 1pbshnw9_10
    Snippet: The first 20 nt of the 3' adapter sequence CTGTAGGCACCATCAATAGA was used to trim adapter sequence from the raw reads using cutadapt (v1.4.2)......
    Document: The first 20 nt of the 3' adapter sequence CTGTAGGCACCATCAATAGA was used to trim adapter sequence from the raw reads using cutadapt (v1.4.2).

    Search related documents:
    Co phrase search for related documents
    • Try single phrases listed below for: 1