Author: William Fitzsimmons; Robert J. Woods; John T. McCrone; Andrew Woodman; Jamie J. Arnold; Madhumita Yennawar; Richard Evans; Craig E. Cameron; Adam S. Lauring
Title: A speed-fidelity trade-off determines the mutation rate and virulence of an RNA virus Document date: 2018_4_27
ID: 8p24gszj_47
Snippet: Passage 1 virus was harvested after an additional 7 hours (8 hours since infection). The titer of 348 the passage 1 virus was used to calculate the dilution factor necessary to maintain an MOI of 349 0.1 for the subsequent 5 passages. RNA was harvested from each passage using Trizol 350 (Ambion 15596026). Random hexamers were used to prime cDNA synthesis with 1/10 of the 351 RNA. Each cDNA was analyzed by real time PCR using three different prime.....
Document: Passage 1 virus was harvested after an additional 7 hours (8 hours since infection). The titer of 348 the passage 1 virus was used to calculate the dilution factor necessary to maintain an MOI of 349 0.1 for the subsequent 5 passages. RNA was harvested from each passage using Trizol 350 (Ambion 15596026). Random hexamers were used to prime cDNA synthesis with 1/10 of the 351 RNA. Each cDNA was analyzed by real time PCR using three different primer and/or probe sets 352 with duplicate PCR reactions for each sample/primer set. The first set, COM2F 5' 353 CATGGCAGCCCCGGAACAGG 3' and COM2R 5' TGTGATGGATCCGGGGGTAGCG 3', was 354 used to quantify total viral genomic RNA in a SYBR green reaction (Power SYBR Green PCR
Search related documents:
Co phrase search for related documents- cdna synthesis and PCR reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
- cdna synthesis and primer set: 1, 2, 3
- cdna synthesis and random hexamer: 1, 2, 3, 4, 5, 6, 7, 8
- cdna synthesis and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- different primer and PCR reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18
- different primer and primer set: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
- different primer and random hexamer: 1
- different primer and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
- different primer probe and PCR reaction: 1, 2, 3, 4, 5, 6
- different primer probe and primer set: 1, 2, 3, 4, 5
- different primer probe and real time: 1, 2, 3, 4, 5
- dilution factor and PCR reaction: 1
- dilution factor and real time: 1
- green reaction and PCR reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- green reaction and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- PCR reaction and primer set: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- PCR reaction and random hexamer: 1, 2, 3, 4
- PCR reaction and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- PCR reaction and sample PCR reaction: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
Co phrase search for related documents, hyperlinks ordered by date