Author: Danielle E Anderson; Jin Cui; Qian Ye; Baoying Huang; Wenhong Zu; Jing Gong; Weiqiang Liu; So Young Kim; Biao Guo Yan; Kristmundur Sigmundsson; Xiao Fang Lim; Fei Ye; Peihua Niu; Xuming Zhou; Wenjie Tan; Lin-Fa Wang; Xu Tan
Title: Orthogonal genome-wide screenings in bat cells identify MTHFD1 as a target of broad antiviral therapy Document date: 2020_3_30
ID: 0l33i6s4_58
Snippet: PaKi shMTHFD1-2 forward primer: 5'-ccgg GCCTGCTGTCACTTAGGAAATctcgag 30 ATTTCCTAAGTGACAGCAGGC tttttg -3' 31 . CC-BY-NC 4.0 International license author/funder. It is made available under a The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020. 03.29.014209 doi: bioRxiv preprint PaKi shMTHFD1-2 reverse primer: 5'-AATTCAAAAA GCCTGCTGTCACTTAGGAAAT 1 CTCGAG ATTTCCTAAGTGACAGCAGGC -3' 2 3.....
Document: PaKi shMTHFD1-2 forward primer: 5'-ccgg GCCTGCTGTCACTTAGGAAATctcgag 30 ATTTCCTAAGTGACAGCAGGC tttttg -3' 31 . CC-BY-NC 4.0 International license author/funder. It is made available under a The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020. 03.29.014209 doi: bioRxiv preprint PaKi shMTHFD1-2 reverse primer: 5'-AATTCAAAAA GCCTGCTGTCACTTAGGAAAT 1 CTCGAG ATTTCCTAAGTGACAGCAGGC -3' 2 3
Search related documents:
Co phrase search for related documents, hyperlinks ordered by date