Selected article for: "Try single phrases listed below for"

Author: Puglisi, Joseph D.; Wyatt, Jacqueline R.; Tinoco, Ignacio
Title: Conformation of an RNA pseudoknot
  • Cord-id: ps4y6kri
  • Document date: 1990_7_20
  • ID: ps4y6kri
    Snippet: Abstract The structure of the 5′ GCGAUUUCUGACCGCUUUUUUGUCAG 3′ RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformatio
    Document: Abstract The structure of the 5′ GCGAUUUCUGACCGCUUUUUUGUCAG 3′ RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3′-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

    Search related documents:
    Co phrase search for related documents
    • Try single phrases listed below for: 1