Saturation mutagenesis genome engineering of infective FX174 bacteriophage via unamplified oligo pools and golden gate assembly

Matthew S. Faber; James T. Van Leuven; Martina M. Ederer; Yesol Sapozhnikov; Zoë L. Wilson; Holly A. Wichman; Timothy A. Whitehead; Craig R. Miller

Raw sequencing reads for the truncated mutant libraries have been deposited in the SRA database: SAMN12660301-SAMN12660308. The processed data is available in the supporting information. Additionally, the oligo pool sequences, input files for generating the oligo pool, and an example of the command line input to execute the script from Medina-Cucurella et al. (2019) Note S1: DNA sequences of ΦX174 viral capsid protein gene fragments. Sequences provided span from the 5' EcoRV to the 3' BamHI site (bolded sequences). Mutagenic regions are highlighted in pink, non-mutated coding regions are highlighted in blue, BsmBI sites are highlighted in green. Regions with overlapping protein coding regions on different reading frames are colored dark blue. GACCATGCCGCTTTTCTTGGCACGATTAACCCTGATACCAATAAAATCCCTAA GCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTAAAGCGCCGT GGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCC TCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACA TTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGAT TACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAACCTC TTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGGAG ACGAAGGGCGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCC >Fragment_F3 GATATCTGCAGAATTCGCCCTTCGTCTCTCTGGGCATCTGGCTATGATGTTGA TGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCT ATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTC TTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCAGTACCTTAAC GCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTGTATGG CAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATT CGTCTAAGAAGTTTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCG TATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAACCG CCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCA GTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATG TGACCGTTTATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGA . CC-BY-NC 4.0 International license is made available under a The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. Figure S1 . Introduction of nicking sites into shuttle vectors containing viral genes. Verification of the introduction of the BbvCI nicking site into the shuttle vector containing the viral genes is shown by the template prep step in the nicking mutagenesis protocol (generation of ssDNA). Samples were run on a 1% agarose gel with SYBR™ Safe DNA gel stain (Invitrogen) added before casting, the ladder used is the 1 kb DNA ladder from GoldBio. The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. It . https://doi.org/10.1101/798546 doi: bioRxiv preprint Supplementary Figure S10: Agarose gel image showing effectiveness of DNase1 in ΦLB. 25 cycles of PCR were performed after a 1-hour 37°C incubation of WT ligation mix with DNase1. Primer sequences for phix_2375F and phix_2949R were 5'-ACACTGACGACATGGTTCTACAtctgcttaggagtttaatc-3' and 5'-TACGGTAGCAGAGACTTGGTCTgcaccaaacataaatcacc-3'. These primers include annealing sequences for Illumina 2 nd round barcoding primers. . CC-BY-NC 4.0 International license is made available under a The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. It . https://doi.org/10.1101/798546 doi: bioRxiv preprint Supplemental Table S5 . Viral growth rate during transformation cell recovery. Viral titers immediately after transformation (0 min) and then for every 30 min after up to 2 hours. As the XL1-Blue cells are not susceptible, the increase in titer is the result