Selected article for: "FLAG tag sequence and tag sequence"

Author: K. Reddisiva Prasanth; Minato Hirano; W. Samuel Fagg; Eileen T. McAnarney; Chao Shan; Xuping Xie; Adam Hage; Colette A. Pietzsch; Alexander Bukreyev; Ricardo Rajsbaum; Pei-Yong Shi; Mark T. Bedford; Shelton S. Bradrick; Vineet Menachery; Mariano A. Garcia-Blanco
Title: Topoisomerase III-ß is required for efficient replication of positive-sense RNA viruses
  • Document date: 2020_3_27
  • ID: a0xfb9l4_16
    Snippet: Rabbit monoclonal antibody against TOP3B was obtained from ABcam (ab183520). Rabbit monoclonal antibodies against GFP were obtained from ThermoFisher Scientific (G10362). The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.03.24.005900 doi: bioRxiv preprint Plasmid construction. To construct CRISPR editing plasmids targeting TDRD3 (pX330-TDRD gRNA1, pX330-TDRD gRNA1) or TOP3B gene (px330-TOP3.....
    Document: Rabbit monoclonal antibody against TOP3B was obtained from ABcam (ab183520). Rabbit monoclonal antibodies against GFP were obtained from ThermoFisher Scientific (G10362). The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.03.24.005900 doi: bioRxiv preprint Plasmid construction. To construct CRISPR editing plasmids targeting TDRD3 (pX330-TDRD gRNA1, pX330-TDRD gRNA1) or TOP3B gene (px330-TOP3B gRNA1, pX330-TDRD gRNA2), oligo sequences provided upon request, were purchased from IDT and were sub-cloned into pX330 as described previously 20 . To generate pFLAG-TOP3B, human Full-length Top3B with FLAG-Tag sequence was amplified using the following set of primers: forward (5′-CCCAAGCTTATGGATTACAAGGATGACGACGATAAGAAGACTGTGCTCATGGTTGCT GAA-3′) and reverse (5′-CGCGGATCCTCATACAAAGTAGGCGGCCAGGGCTGACAT -3′).

    Search related documents:
    Co phrase search for related documents