Author: Rohan Maddamsetti; Daniel T. Johnson; Stephanie J. Spielman; Katherine L. Petrie; Debora S. Marks; Justin R. Meyer
                    Title: Viral gain-of-function experiments uncover residues under diversifying selection in nature  Document date: 2018_1_3
                    ID: gqhlw20n_18
                    
                    Snippet: To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 . Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility. Unpurified PCR products (Forward primer: 5' CGCATCGTTCACCTCTCACT; Reverse primer: 5' CCTGCGGGCGGTTTGTCATTT) were submitted......
                    
                    
                    
                     
                    
                    
                    
                    
                        
                            
                                Document: To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 . Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility. Unpurified PCR products (Forward primer: 5' CGCATCGTTCACCTCTCACT; Reverse primer: 5' CCTGCGGGCGGTTTGTCATTT) were submitted.
 
  Search related documents: 
                                Co phrase  search for related documents- Forward primer and lamb coli: 1
- Forward primer and PCR product: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
- Forward primer and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81
- KEIO collection and lamb coli: 1
- KEIO collection and reverse primer: 1
- lamb coli and reverse primer: 1
- PCR product and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
 
                                Co phrase  search for related documents, hyperlinks ordered by date