Author: Rohan Maddamsetti; Daniel T. Johnson; Stephanie J. Spielman; Katherine L. Petrie; Debora S. Marks; Justin R. Meyer
Title: Viral gain-of-function experiments uncover residues under diversifying selection in nature Document date: 2018_1_3
ID: gqhlw20n_18
Snippet: To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 . Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility. Unpurified PCR products (Forward primer: 5' CGCATCGTTCACCTCTCACT; Reverse primer: 5' CCTGCGGGCGGTTTGTCATTT) were submitted......
Document: To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 . Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility. Unpurified PCR products (Forward primer: 5' CGCATCGTTCACCTCTCACT; Reverse primer: 5' CCTGCGGGCGGTTTGTCATTT) were submitted.
Search related documents:
Co phrase search for related documents- Forward primer and lamb coli: 1
- Forward primer and PCR product: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12
- Forward primer and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- KEIO collection and lamb coli: 1
- KEIO collection and reverse primer: 1
- lamb coli and reverse primer: 1
- PCR product and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
Co phrase search for related documents, hyperlinks ordered by date