Author: Lunwen Wang; Xun Li; Hui Chen; Shaonan Yan; Yan Li; Dong Li; Zuojiong Gong
Title: SARS-CoV-2 infection does not significantly cause acute renal injury: an analysis of 116 hospitalized patients with COVID-19 in a single hospital, Wuhan, China Document date: 2020_2_23
ID: 368pz09b_13
Snippet: The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.02. 19.20025288 doi: medRxiv preprint was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including NP and ORF1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (NP): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTC AAGCTG; and the probe 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA.....
Document: The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.02. 19.20025288 doi: medRxiv preprint was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including NP and ORF1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (NP): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTC AAGCTG; and the probe 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'. Target 2 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGC ATCAGCTGA; and the probe 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 -3'.
Search related documents:
Co phrase search for related documents- real time and SARS RNA RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9
- real time and simultaneously amplify: 1, 2
- real time and target gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- real time RT PCR assay and RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- real time RT PCR assay and SARS RNA RT PCR assay: 1, 2, 3, 4, 5, 6
- real time RT PCR assay and target gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
- real time RT PCR assay test and RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
- real time RT PCR assay test and SARS RNA RT PCR assay: 1
- RT PCR assay and SARS RNA RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
- RT PCR assay and simultaneously amplify: 1
- RT PCR assay and target gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
Co phrase search for related documents, hyperlinks ordered by date