Selected article for: "real time and RNA target"

Author: Lunwen Wang; Xun Li; Hui Chen; Shaonan Yan; Yan Li; Dong Li; Zuojiong Gong
Title: SARS-CoV-2 infection does not significantly cause acute renal injury: an analysis of 116 hospitalized patients with COVID-19 in a single hospital, Wuhan, China
  • Document date: 2020_2_23
  • ID: 368pz09b_13
    Snippet: The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.02. 19.20025288 doi: medRxiv preprint was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including NP and ORF1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (NP): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTC AAGCTG; and the probe 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA.....
    Document: The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.02. 19.20025288 doi: medRxiv preprint was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including NP and ORF1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (NP): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTC AAGCTG; and the probe 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'. Target 2 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGC ATCAGCTGA; and the probe 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 -3'.

    Search related documents:
    Co phrase search for related documents