Author: Lunwen Wang; Xun Li; Hui Chen; Shaonan Yan; Yan Li; Dong Li; Zuojiong Gong
                    Title: SARS-CoV-2 infection does not significantly cause acute renal injury: an analysis of 116 hospitalized patients with COVID-19 in a single hospital, Wuhan, China  Document date: 2020_2_23
                    ID: 368pz09b_13
                    
                    Snippet: The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.02. 19.20025288 doi: medRxiv preprint was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including NP and ORF1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (NP): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTC AAGCTG; and the probe 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA.....
                    
                    
                    
                     
                    
                    
                    
                    
                        
                            
                                Document: The copyright holder for this preprint (which was not peer-reviewed) is the . https://doi.org/10.1101/2020.02. 19.20025288 doi: medRxiv preprint was used for RT-PCR assay of SARS-CoV-2 RNA. Two target genes, including NP and ORF1ab, were simultaneously amplified and tested during the real-time RT-PCR assay. Target 1 (NP): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTC AAGCTG; and the probe 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3'. Target 2 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGC ATCAGCTGA; and the probe 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 -3'.
 
  Search related documents: 
                                Co phrase  search for related documents- real time and SARS RNA RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9
  - real time and simultaneously amplify: 1, 2
  - real time and target gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74
  - real time RT PCR assay and RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79
  - real time RT PCR assay and SARS RNA RT PCR assay: 1, 2, 3, 4, 5, 6
  - real time RT PCR assay and target gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
  - real time RT PCR assay test and RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
  - real time RT PCR assay test and SARS RNA RT PCR assay: 1
  - RT PCR assay and SARS RNA RT PCR assay: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27
  - RT PCR assay and simultaneously amplify: 1
  - RT PCR assay and target gene: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
  
 
                                Co phrase  search for related documents, hyperlinks ordered by date