Author: Cheung, Benny KW; Yim, Howard CH; Lee, Norris CM; Lau, Allan SY
Title: A novel anti-mycobacterial function of mitogen-activated protein kinase phosphatase-1 Document date: 2009_12_17
ID: 134qz0aw_45
Snippet: Transfection of siRNA into human monocytes was done as described [21] . MKP-1 siRNA included (i) MKP1-HSS102982, AAACGCUUCGUAUCCUCCUUUGAGG; (ii) MKP1-HSS102983, UUAUGCCCAAGGCAUCCAG-CAUGUC; and (iii) MKP1-HSS102984, UGAUG-GAGUCUAUGAAGUCAAUGGC. MKP-1 knockdown in PBMo was conducted by using MKP1-HSS102983 only or a pool of the above three different MKP-1 Stealthâ„¢ Select RNAi (ratio = 1:1:1, 200 nM, Invitrogen, USA). Stealthâ„¢ RNAi Negative Contr.....
Document: Transfection of siRNA into human monocytes was done as described [21] . MKP-1 siRNA included (i) MKP1-HSS102982, AAACGCUUCGUAUCCUCCUUUGAGG; (ii) MKP1-HSS102983, UUAUGCCCAAGGCAUCCAG-CAUGUC; and (iii) MKP1-HSS102984, UGAUG-GAGUCUAUGAAGUCAAUGGC. MKP-1 knockdown in PBMo was conducted by using MKP1-HSS102983 only or a pool of the above three different MKP-1 Stealthâ„¢ Select RNAi (ratio = 1:1:1, 200 nM, Invitrogen, USA). Stealthâ„¢ RNAi Negative Control Duplex (200 nM) was used as a control for sequence independent effects for the siRNA transfection. Transfection of monocytes was done by using jetPEIâ„¢ DNA transfection reagent (Polyplus Transfection, USA) according to the manufacturer's instructions. After transfecting the cells for 24 h, the transfectants were treated with different inducers as described above.
Search related documents:
Co phrase search for related documents- PBMo knockdown and siRNA transfection: 1
Co phrase search for related documents, hyperlinks ordered by date