A Replicating Modified Vaccinia Tiantan Strain Expressing an Avian-Derived Influenza H5N1 Hemagglutinin Induce Broadly Neutralizing Antibodies and Cross-Clade Protective Immunity in Mice

Xiao, Haixia; Liu, Li; Zhu, Qingyu; Tan, Zhiwu; Yu, Wenbo; Tang, Xian; Zhan, Dawei; Du, Yanhua; Wang, Haibo; Liu, Di; Li, Zhixin; Yuen, Kwok-Yung; Ho, David D.; Gao, George F.; Chen, Zhiwei

The HA gene of A/BhG/QH/1/05 was amplified from the total RNA of the virus by RT-PCR. The HA gene of A/Anhui/1/ 2005 was kindly provided by Dr. David Ho and amplified by PCR. Each HA ORF gene was then inserted into a vaccinia shuttle vector pZC XZ under the strong synthetic promoter pSYN and subsequently recombined into the promoter region of the MVTT HA gene to generate MVTT HA-QH and MVTT HA-AH using a homologous recombination method by transfection, as previously described [26] . In brief, Vero cells were infected with MVTT and subsequently transfected with a shuttle vector pZCxz containing the HA gene of influenza H5N1 flanked with MVTT HA sequences [26] . The recombinant virus was selected through six rounds of plaque purification under agar and confirmed by immunostaining assay using an anti-H5 serum [26] . The insertion of full length gene of H5N1 HA was further confirmed by PCR using specific primers. Total DNA was extracted from MVTT HA-QH , MVTT HA-AH or MVTT SIV infected Vero cells as described before [24] . The presence of full-length H5N1 HA genes were evidenced by the amplification of around 1700 bp fragments using the following pairs of primers: Anhui-F 59-ATGGAGAA-GATCGTGCTGCTG, and Anhui-B 59-GATGCAGATTCTG-CACTGCAGGCT; Qinghai-F 59 ATGGAGAAAATAG-TGCTTCT: Qinghai-B 59 AATGCAAATTCTGCATTGTA, respectively. MVTT HA-QH and MVTT HA-AH viral stocks were propagated in Vero cells and then purified by ultracentrifugation through a 36% sucrose cushion. Both viral stocks were titrated simultaneously in Vero cells by a plaque forming assay using crystal violet staining or counting the plaques with GFP expression [26] .