Selected article for: "agarose gel and final extension"

Author: Shehata, Mahmoud M.; Kandeil, Ahmed; Mostafa, Ahmed; Mahmoud, Sara H.; Gomaa, Mokhtar R.; El-Shesheny, Rabeh; Webby, Richard; Kayali, Ghazi; A. Ali, Mohamed
Title: A Recombinant Influenza A/H1N1 Carrying A Short Immunogenic Peptide of MERS-CoV as Bivalent Vaccine in BALB/c Mice
  • Document date: 2019_12_2
  • ID: 15q6qr4z_21
    Snippet: We inserted a short immunogenic (25 aa) peptide 736 CALPDTPSTLTPRSVRSVPGEMRLA 761 from spike glycoprotein of MERS-CoV into the NA gene of H1N1pdm09 virus as illustrated in Figure 1A . To construct the chimeric pHW-NAH1N1pdm09-MERS-CoV plasmid, two PCR fragments were amplified using Ba-NA-1F: TATTGGTCTCAGGGAGCAAAAGCAGGAGT; Ba-NA-pdm09-peptide-R1: ATATGGTCTCACTGCGAGGTGTGAGAGTACTAGGTGTGTCAGG AAGA-GCACATGTTTCAATCTGATTTTGATT for fragment 1, and Ba-NA-.....
    Document: We inserted a short immunogenic (25 aa) peptide 736 CALPDTPSTLTPRSVRSVPGEMRLA 761 from spike glycoprotein of MERS-CoV into the NA gene of H1N1pdm09 virus as illustrated in Figure 1A . To construct the chimeric pHW-NAH1N1pdm09-MERS-CoV plasmid, two PCR fragments were amplified using Ba-NA-1F: TATTGGTCTCAGGGAGCAAAAGCAGGAGT; Ba-NA-pdm09-peptide-R1: ATATGGTCTCACTGCGAGGTGTGAGAGTACTAGGTGTGTCAGG AAGA-GCACATGTTTCAATCTGATTTTGATT for fragment 1, and Ba-NA-pdm09-peptide-F2: ATTGGTCTCAGCAGTGTGCGCTCTGTTCCAGGTGAAATGCGCTTGGCATGCAATCAAAGCGTC ATTACTTATG and Ba-NA-1413R: ATATGGTCTCGTATTAGT-AGAAACAAGGAGTTTTTT for fragment 2. Using Phusion Master Mix (Thermo, Waltham, MA, USA), in a total reaction 50 µL: 25 µL master mix, 3 µL each forward and reverse primers for each fragment, ddH2O 18 µL and template DNA (pHW-NAH1N1pdm09) 1 µL were mixed. Cycler conditions were 95 • C for 1 min followed by three steps (95 • C for 10 s, 58 • C for 30 s, and 72 • C for 2 min) for 40 cycles then final extension at 72 • C for 10 min. The two fragments were loaded in 1% agarose electrophoresis then bands were purified using QIAquick gel purification kit (Qiagen, Hilden, Germany). After purification, the two fragments digested with Bsa I (NEB, Ipswich, MA, USA). Ligation of the two fragments and BsmBI linearized pHW2000 [29] was done using T4 DNA ligase (Promega, Madison, WI, USA) overnight at 4 • C. Transformation using Top 10 competent cells was performed according to instructions. Colonies were selected for mini-prep. The purified construct was prepared for sequencing at Macrogen facility (Macrogen, Seoul, South Korea).

    Search related documents:
    Co phrase search for related documents
    • agarose electrophoresis and dna template: 1, 2, 3, 4, 5, 6
    • agarose electrophoresis and final extension: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • agarose electrophoresis and gel purification kit: 1
    • agarose electrophoresis and master mix: 1, 2, 3
    • agarose electrophoresis and PCR fragment: 1, 2, 3
    • agarose electrophoresis and primer reverse: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
    • agarose electrophoresis and purification kit: 1, 2, 3
    • agarose electrophoresis and total reaction: 1, 2, 3, 4, 5
    • competent cell and primer reverse: 1