Author: Gwon, Yong-Dae; Strand, Mårten; Lindqvist, Richard; Nilsson, Emma; Saleeb, Michael; Elofsson, Mikael; Överby, Anna K.; Evander, Magnus
                    Title: Antiviral Activity of Benzavir-2 against Emerging Flaviviruses  Document date: 2020_3_22
                    ID: 0ym40eki_23
                    
                    Snippet: To quantify the virus RNA in the supernatant, viral RNA was isolated from 100 µL of supernatant by using a viral RNA isolation kit (Macherey Nagel, Dueren, Germany), and a first strand synthesis kit with ZIKV specific primers was used to synthesize cDNA (Thermo Fisher, Waltham, MA, USA). To perform real-time qPCR, synthesized cDNA was used as a template in a mixture of SYBR master mix (KAPA Biosystems, Switzerland) and ZIKV NS5 specific primers .....
                    
                    
                    
                     
                    
                    
                    
                    
                        
                            
                                Document: To quantify the virus RNA in the supernatant, viral RNA was isolated from 100 µL of supernatant by using a viral RNA isolation kit (Macherey Nagel, Dueren, Germany), and a first strand synthesis kit with ZIKV specific primers was used to synthesize cDNA (Thermo Fisher, Waltham, MA, USA). To perform real-time qPCR, synthesized cDNA was used as a template in a mixture of SYBR master mix (KAPA Biosystems, Switzerland) and ZIKV NS5 specific primers (Forward: GTACATGGACTACCTATCCACC, Reverse: CTGACTAGCAGGCCTGACAAC). The qPCR reaction was carried out with the StepOnePlus™ Real-Time PCR system (Thermo Fisher, Waltham, MA, USA). Obtained cycle threshold (Ct) values were converted to the actual copy number of ZIKV NS5 genes by using a standard curve.
 
  Search related documents: 
                                Co phrase  search for related documents- copy number and cycle threshold: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
  - copy number and master mix: 1, 2, 3, 4, 5, 6, 7, 8
  - copy number and pcr system: 1, 2, 3, 4, 5, 6
  - copy number and qPCR reaction: 1, 2, 3, 4, 5, 6, 7, 8
  - copy number and Real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53
  - copy number and Real time pcr system: 1
  - copy number and real time qpcr: 1, 2, 3, 4, 5, 6, 7, 8
  - copy number and specific primer: 1, 2, 3, 4
  - copy number and standard curve: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15
  - copy number and sybr master mix: 1, 2, 3
  - copy number and synthesis kit: 1, 2
  - copy number and virus rna: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26
  - copy number and virus rna quantify: 1
  - Ct value and cycle threshold: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75
  - Ct value and isolation kit: 1
  - Ct value and master mix: 1, 2, 3, 4, 5
  - Ct value and obtain cycle threshold: 1, 2
  - Ct value and pcr system: 1, 2, 3, 4, 5, 6, 7
  - Ct value and qPCR reaction: 1, 2, 3, 4, 5, 6, 7
  
 
                                Co phrase  search for related documents, hyperlinks ordered by date