Selected article for: "cdna synthesis and real time"

Author: Gwon, Yong-Dae; Strand, Mårten; Lindqvist, Richard; Nilsson, Emma; Saleeb, Michael; Elofsson, Mikael; Överby, Anna K.; Evander, Magnus
Title: Antiviral Activity of Benzavir-2 against Emerging Flaviviruses
  • Document date: 2020_3_22
  • ID: 0ym40eki_23
    Snippet: To quantify the virus RNA in the supernatant, viral RNA was isolated from 100 µL of supernatant by using a viral RNA isolation kit (Macherey Nagel, Dueren, Germany), and a first strand synthesis kit with ZIKV specific primers was used to synthesize cDNA (Thermo Fisher, Waltham, MA, USA). To perform real-time qPCR, synthesized cDNA was used as a template in a mixture of SYBR master mix (KAPA Biosystems, Switzerland) and ZIKV NS5 specific primers .....
    Document: To quantify the virus RNA in the supernatant, viral RNA was isolated from 100 µL of supernatant by using a viral RNA isolation kit (Macherey Nagel, Dueren, Germany), and a first strand synthesis kit with ZIKV specific primers was used to synthesize cDNA (Thermo Fisher, Waltham, MA, USA). To perform real-time qPCR, synthesized cDNA was used as a template in a mixture of SYBR master mix (KAPA Biosystems, Switzerland) and ZIKV NS5 specific primers (Forward: GTACATGGACTACCTATCCACC, Reverse: CTGACTAGCAGGCCTGACAAC). The qPCR reaction was carried out with the StepOnePlus™ Real-Time PCR system (Thermo Fisher, Waltham, MA, USA). Obtained cycle threshold (Ct) values were converted to the actual copy number of ZIKV NS5 genes by using a standard curve.

    Search related documents:
    Co phrase search for related documents