Selected article for: "isolation kit and master mix"

Author: Gwon, Yong-Dae; Strand, Mårten; Lindqvist, Richard; Nilsson, Emma; Saleeb, Michael; Elofsson, Mikael; Överby, Anna K.; Evander, Magnus
Title: Antiviral Activity of Benzavir-2 against Emerging Flaviviruses
  • Document date: 2020_3_22
  • ID: 0ym40eki_23
    Snippet: To quantify the virus RNA in the supernatant, viral RNA was isolated from 100 µL of supernatant by using a viral RNA isolation kit (Macherey Nagel, Dueren, Germany), and a first strand synthesis kit with ZIKV specific primers was used to synthesize cDNA (Thermo Fisher, Waltham, MA, USA). To perform real-time qPCR, synthesized cDNA was used as a template in a mixture of SYBR master mix (KAPA Biosystems, Switzerland) and ZIKV NS5 specific primers .....
    Document: To quantify the virus RNA in the supernatant, viral RNA was isolated from 100 µL of supernatant by using a viral RNA isolation kit (Macherey Nagel, Dueren, Germany), and a first strand synthesis kit with ZIKV specific primers was used to synthesize cDNA (Thermo Fisher, Waltham, MA, USA). To perform real-time qPCR, synthesized cDNA was used as a template in a mixture of SYBR master mix (KAPA Biosystems, Switzerland) and ZIKV NS5 specific primers (Forward: GTACATGGACTACCTATCCACC, Reverse: CTGACTAGCAGGCCTGACAAC). The qPCR reaction was carried out with the StepOnePlus™ Real-Time PCR system (Thermo Fisher, Waltham, MA, USA). Obtained cycle threshold (Ct) values were converted to the actual copy number of ZIKV NS5 genes by using a standard curve.

    Search related documents:
    Co phrase search for related documents
    • copy number and cycle threshold: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17
    • copy number and master mix: 1, 2, 3, 4, 5, 6, 7, 8
    • copy number and pcr system: 1, 2, 3, 4, 5, 6
    • copy number and qPCR reaction: 1, 2, 3, 4, 5, 6, 7, 8
    • copy number and Real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • copy number and Real time pcr system: 1
    • copy number and real time qpcr: 1, 2, 3, 4, 5, 6, 7, 8
    • copy number and specific primer: 1, 2, 3, 4
    • copy number and standard curve: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15
    • copy number and sybr master mix: 1, 2, 3
    • Ct value and pcr system: 1, 2, 3, 4, 5, 6, 7
    • Ct value and qPCR reaction: 1, 2, 3, 4, 5, 6, 7
    • Ct value and Real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • Ct value and Real time pcr system: 1, 2, 3
    • Ct value and real time qpcr: 1, 2, 3, 4, 5, 6, 7, 8
    • Ct value and RNA isolation kit: 1
    • Ct value and specific primer: 1, 2, 3
    • Ct value and standard curve: 1, 2, 3, 4, 5
    • Ct value and sybr master mix: 1