Selected article for: "antisense primer and PCR amplification"
Author: Meng, Fandan; Ren, Yudong; Suo, Siqingaowa; Sun, Xuejiao; Li, Xunliang; Li, Pengchong; Yang, Wei; Li, Guangxing; Li, Lu; Schwegmann-Wessels, Christel; Herrler, Georg; Ren, Xiaofeng
Title: Evaluation on the Efficacy and Immunogenicity of Recombinant DNA Plasmids Expressing Spike Genes from Porcine Transmissible Gastroenteritis Virus and Porcine Epidemic Diarrhea Virus
  • Document date: 2013_3_19
    • ID: 081o2zmd_7
    Snippet: Construction of plasmids containing genes encoding TGEV-S1, PEDV-S1 and PEDV-S The plasmid pcDNA3.1-TGEV-S containing the full-length S gene of TGEV strain Purdue was constructed in our laboratory by common cloning techniques and used as a template for PCR amplification. A sense primer P1 (5' GGGGGCTAGCCCAT-GAAAAAACTATTTG 3') and an antisense primer P2 (5' CCCCGAATTCTTAGTTTGTCTAATAA 3') which contain NheI (P1) and EcoRI (P2) restriction enzyme si.....
    Document: Construction of plasmids containing genes encoding TGEV-S1, PEDV-S1 and PEDV-S The plasmid pcDNA3.1-TGEV-S containing the full-length S gene of TGEV strain Purdue was constructed in our laboratory by common cloning techniques and used as a template for PCR amplification. A sense primer P1 (5' GGGGGCTAGCCCAT-GAAAAAACTATTTG 3') and an antisense primer P2 (5' CCCCGAATTCTTAGTTTGTCTAATAA 3') which contain NheI (P1) and EcoRI (P2) restriction enzyme sites (underlined), were used for PCR. The plasmid Easy-T-S containing the full-length S gene of PEDV strain CV777 was constructed in our laboratory by common cloning techniques and used as a template for PCR amplification. A sense primer P3 (5' GGGGGTCGACATG-GATGTCACTAGGTGCC 3'), two antisense primers P4 (5'CCCCGCGGCCGCTCAAATACTCATACTAAA 3') and P5 (5' CCCCGCGGCCGCTCATCTCTGCACGTGGAC 3') which contain SalI (P3) and NotI (P4 and P5) restriction enzyme sites (underlined), were used for PCR.

    Search related documents:
    Co phrase search for related documents
    • enzyme site and restriction enzyme: 1, 2, 3, 4, 5, 6
    • enzyme site and restriction enzyme site: 1, 2, 3, 4, 5, 6
    • enzyme site and TGEV strain: 1
    • enzyme site and underlined restriction enzyme site: 1
    • PCR amplification and PEDV strain: 1
    • PCR amplification and restriction enzyme: 1, 2, 3, 4, 5, 6, 7
    • PCR amplification and restriction enzyme site: 1
    • PCR amplification and TGEV strain: 1, 2
    • PCR amplification and underlined restriction enzyme site: 1
    • PEDV strain and restriction enzyme: 1, 2, 3, 4
    • PEDV strain and TGEV strain: 1, 2
    • plasmid construction and restriction enzyme: 1
    • restriction enzyme and TGEV strain: 1, 2, 3
    • restriction enzyme and underlined restriction enzyme site: 1
    • restriction enzyme site and TGEV strain: 1
    • restriction enzyme site and underlined restriction enzyme site: 1
    • TGEV strain and underlined restriction enzyme site: 1