Selected article for: "Applied Biosystems real Time pcr system and pcr system"

Author: Magold, Alexandra I.; Cacquevel, Matthias; Fraering, Patrick C.
Title: Gene Expression Profiling in Cells with Enhanced ?-Secretase Activity
  • Document date: 2009_9_18
  • ID: 0p8lk12m_46
    Snippet: Reverse transcription products were used without purification for real time PCR at equivalent of 0.5 ng/ml RNA in 384 well plates. Samples were used as biological triplicates and each one was additionally pipetted as a triplicate. Reaction volumes were 10 ml consisting of 5.02 ml SYBR Green (Power SYBR Green Master Mix #4367660 Applied Biosystems, Cheshire UK), 1.49 ml RT-PCR product at 0.5 ng/ml input RNA equivalent (0.75 ng/rxn) and 3.49 ml of .....
    Document: Reverse transcription products were used without purification for real time PCR at equivalent of 0.5 ng/ml RNA in 384 well plates. Samples were used as biological triplicates and each one was additionally pipetted as a triplicate. Reaction volumes were 10 ml consisting of 5.02 ml SYBR Green (Power SYBR Green Master Mix #4367660 Applied Biosystems, Cheshire UK), 1.49 ml RT-PCR product at 0.5 ng/ml input RNA equivalent (0.75 ng/rxn) and 3.49 ml of 3 mM Forward and Reverse primer mix. 384 well plates were prepared with a liquid handling robot (Freedom EVOware Tecan Trading AG, Switzerland) and read for relative quantification with Applied Biosystems 7900HT Real-Time PCR System (Applied Biosystems, Cheshire UK). Primers (synthesized by Eurogentec Seraing, Belgium) for CHO cDNA were based on mouse code, which was aligned with rat and human code, preference was given to aligning sequences (Table 3) . Sequence specificity was determined via nBlast. b-actin was used as housekeeping gene [82] [83] [84] [85] [86] [87] [88] [89] for CHO as well as human cortex templates with the forward sequence: CCTTCAACACCCCAGCCATGTACG and the reverse sequence: CCTTCAACACCCCAGCCATGTACG.

    Search related documents:
    Co phrase search for related documents
    • housekeeping gene and human cortex: 1
    • housekeeping gene and primer mix: 1, 2
    • housekeeping gene and reaction volume: 1
    • housekeeping gene and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • human cortex and real time: 1, 2, 3, 4
    • human rat and real time: 1, 2, 3, 4, 5
    • primer mix and reaction volume: 1, 2, 3, 4, 5, 6, 7, 8
    • primer mix and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19