Selected article for: "mouse human and reverse primer"

Author: Magold, Alexandra I.; Cacquevel, Matthias; Fraering, Patrick C.
Title: Gene Expression Profiling in Cells with Enhanced ?-Secretase Activity
  • Document date: 2009_9_18
  • ID: 0p8lk12m_46
    Snippet: Reverse transcription products were used without purification for real time PCR at equivalent of 0.5 ng/ml RNA in 384 well plates. Samples were used as biological triplicates and each one was additionally pipetted as a triplicate. Reaction volumes were 10 ml consisting of 5.02 ml SYBR Green (Power SYBR Green Master Mix #4367660 Applied Biosystems, Cheshire UK), 1.49 ml RT-PCR product at 0.5 ng/ml input RNA equivalent (0.75 ng/rxn) and 3.49 ml of .....
    Document: Reverse transcription products were used without purification for real time PCR at equivalent of 0.5 ng/ml RNA in 384 well plates. Samples were used as biological triplicates and each one was additionally pipetted as a triplicate. Reaction volumes were 10 ml consisting of 5.02 ml SYBR Green (Power SYBR Green Master Mix #4367660 Applied Biosystems, Cheshire UK), 1.49 ml RT-PCR product at 0.5 ng/ml input RNA equivalent (0.75 ng/rxn) and 3.49 ml of 3 mM Forward and Reverse primer mix. 384 well plates were prepared with a liquid handling robot (Freedom EVOware Tecan Trading AG, Switzerland) and read for relative quantification with Applied Biosystems 7900HT Real-Time PCR System (Applied Biosystems, Cheshire UK). Primers (synthesized by Eurogentec Seraing, Belgium) for CHO cDNA were based on mouse code, which was aligned with rat and human code, preference was given to aligning sequences (Table 3) . Sequence specificity was determined via nBlast. b-actin was used as housekeeping gene [82] [83] [84] [85] [86] [87] [88] [89] for CHO as well as human cortex templates with the forward sequence: CCTTCAACACCCCAGCCATGTACG and the reverse sequence: CCTTCAACACCCCAGCCATGTACG.

    Search related documents:
    Co phrase search for related documents
    • primer mix and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19
    • primer mix and reverse Forward primer mix: 1, 2, 3, 4, 5
    • primer mix and reverse sequence: 1
    • reaction volume and real time: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22
    • reaction volume and relative quantification: 1
    • reaction volume and reverse Forward primer mix: 1
    • reaction volume and reverse sequence: 1
    • reaction volume and RT PCR product: 1
    • real time and relative quantification: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20
    • real time and reverse Forward primer mix: 1, 2
    • real time and reverse sequence: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
    • real time and reverse transcription product: 1, 2
    • real time and RT PCR product: 1, 2, 3
    • real time and sequence specificity: 1, 2, 3, 4
    • real time and transcription product: 1
    • relative quantification and sample biological triplicate: 1
    • reverse sequence and sequence specificity: 1
    • reverse transcription product and transcription product: 1, 2, 3, 4, 5