Interferon-induced transmembrane protein 3 blocks fusion of sensitive but not resistant viruses by partitioning into virus-carrying endosomes

Suddala, Krishna C.; Lee, Christine C.; Meraner, Paul; Marin, Mariana; Markosyan, Ruben M.; Desai, Tanay M.; Cohen, Fredric S.; Brass, Abraham L.; Melikyan, Gregory B.

To internally label human IFITM3 (accession NM_021034) with EGFP, sites likely permissive to insertions were identified based on sequence alignments of human and mouse IFITM family proteins. An EGFP cassette flanked by two linkers was created by PCR (forward primer TCAAGGAGGAGCACGAGGTGGCTGTGCTGGGGGCGCCCCACAACCCTGCTCCCGG CGGAGGAAGCGGCGGAGTGAGCAAGGGCGAGGAGC; reverse primer GACGACAT GGTCGGGCACGGAGGTCTCGCTGCGGATGTGGATCACGGTGGATCCGCCTCCGC TTCCGCCCTTGTACAGCTCGTCCATGCC) and inserted using Gibson assembly into KasI/ BsaBI-cut IFITM3 cDNA. The resulting protein has amino acids 41 (P) and 42 (T) of wildtype IFITM3 removed. The cloning of IFITM3-imNeonGreen (IFITM3-imNG), and IFIT-M3-imTFP1 (IFITM3-imTFP1) into pQCXIN (Clontech) and pQXCIP (Clontech) retroviral expression vectors were done in two steps. In the first step, the EGFP in IFITM3-iEGFP/pLVX Tet on construct was replaced either with mNeonGreen or mTFP1 by overlapping PCR. The IFITM3-iEGFP/pLVX Tet on construct contain an EcoRI restriction site in the 5' of the IFIT-M3-iEGFP cDNA and a BsrgGI in the 3' of GFP cDNA that facilitated the replacement of GFP. The 5' of IFITM3 cDNA was amplified by PCR using forward primer P1 (containing EcoRI restriction site) TACCACTTCCTACCCTCGTAAAGAATTCGCCACCATGAATCACACTG TCCAAACCTTC, and reverse primer P2: TGTGGTCTCCTCGCCCTTGCTCACTCCGCC GCTTCCTCCGCCGGGAGC. The mTFP1 fragment was amplified using forward primer P3: GCTCCCGGCGGAGGAAGCGGCGGAGTGAGCAAGGGCGAGGAGACCACA (complementary to P2), and the reverse primer P3 (containing BsrgGI restriction site) GAT CCGCCTCCGCTTCCGCCCTTGTACAGCTCGTCCATGCCGTCGGTGGAATT. The fragments were purified, mixed and the overlapping PCR was perfomed using the forward primer P1 and the reverse primer P3. The final PCR fragment and IFITM3-iEGFP/pLVX Tet on were digested with EcoRI and BsrgGI restriction enzymes, purified and ligated. In the second step, the IFITM3-imTFP was amplified by PCR with forward primer P4 (containing AgeI restriction site) GCAGGAATTGATCCGCGGCCGCACCGGTAGGCCACCATGAATCACACTGTCC AAACCTTC, and reverse primer P5 (containing EcoRI restriction site) AGGGGTGGGGCG GGGGGGGGCGGAATTCTTAGTGATGGTGATGGTGATGGCCTTG, digested with AgeI and EcoRI restriction enzymes, purified and ligated into pQCXIN or pQXCIP vectors. For IFITM3-imNeonGreen construct the overlapping PCR was done using IFITM3-imTFP/ pQCXIN construct as template and the AgeI and BamHI restriction sites. The 5' of IFITM3 cDNA was amplified by PCR using forward primer P5 (containing AgeI restriction site) GCA GGAATTGATCCGCGGCCGCACCGGTAGGCCACCATGAATCACACTGTCCAAACC TT, and reverse primer P6: ATCCTCCTCGCCCTTGCTCACCATTCCGCCGCTTCCTCCG CCGGGAGC. The mNeonGreen cDNA was amplified with forward primer P7: GCTCCCGG CGGAGGAAGCGGCGGAATGGTGAGCAAGGGCGAGGAGGAT (complementary to P6), and reverse primer (containing BamHI restriction site) CGCTGCGGATGTGGATCACGGT GGATCCGCCTCCGCTTCCGCCCTTGTACAGCTCGTCCATGCCCA. Purified PCR fragments were mixed and the overlapping PCR was done using the forward primer containing AgeI restriction site and the reverse primer containing BamHI restriction site. The fragment and IFITM3-imTFP1 plasmid were digested with AgeI and BamHI, purified and ligated. The F75/F78A IFITM3-imTFP1 (2M-IFITM3-imTFP1) mutants was obtained by Quick-change site-directed mutagenesis (Stratagen, La Jolla, CA) using IFITM3-imTFP1/pQCXIN as template.