Selected article for: "PCR primer and study sequence"

Author: Shabman, Reed S.; Shrivastava, Susmita; Tsibane, Tshidi; Attie, Oliver; Jayaprakash, Anitha; Mire, Chad E.; Dilley, Kari E.; Puri, Vinita; Stockwell, Timothy B.; Geisbert, Thomas W.; Sachidanandam, Ravi; Basler, Christopher F.
Title: Isolation and Characterization of a Novel Gammaherpesvirus from a Microbat Cell Line
  • Document date: 2016_2_17
  • ID: 1a9u53za_35
    Snippet: BGHV8 infection of cell lines. Both TCID 50 and plaque assays were used to calculate viral stock titers. BGHV8 stocks were used to infect target cells at a multiplicity of infection (MOI) of approximately 0.5 PFU/cell. Cell lines tested included mouse embryonic fibroblasts, Hepa1.6, Huh7, MRC, A549, HeLa, and Vero. Both uninfected cells and cells at days 1, 3, and 5 postinfection were collected for total RNA. Corresponding supernatant from each s.....
    Document: BGHV8 infection of cell lines. Both TCID 50 and plaque assays were used to calculate viral stock titers. BGHV8 stocks were used to infect target cells at a multiplicity of infection (MOI) of approximately 0.5 PFU/cell. Cell lines tested included mouse embryonic fibroblasts, Hepa1.6, Huh7, MRC, A549, HeLa, and Vero. Both uninfected cells and cells at days 1, 3, and 5 postinfection were collected for total RNA. Corresponding supernatant from each sample was also harvested, and DNA from supernatants was isolated (QIAamp blood kit). From total RNA, cDNA was generated using oligo(dT) primers (Superscript III; Invitrogen). Quantitative PCR primers designed against a BGHV8 capsid mRNA sequence identified in the initial RNA-seq study were used to measure BGHV8 RNA in cells. The forward primer sequence is 5= ACACCAACAGAGACCCCGCC 3=, and the reverse primer sequence is 5= AGCACGGTCTGGCTTACTTTG CG 3=. To measure particle release from infected cell supernatants, quantitative PCR from isolated DNA was performed with the same primer set.

    Search related documents:
    Co phrase search for related documents
    • blood kit and isolate dna: 1
    • cDNA generate and particle release: 1
    • cDNA generate and PCR primer: 1, 2
    • cell line and embryonic fibroblast: 1, 2, 3, 4, 5, 6, 7, 8
    • cell line and infected cell supernatant: 1
    • cell line and MOI infection: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
    • cell line and mouse embryonic fibroblast: 1, 2, 3
    • cell line and particle release: 1
    • cell line and PCR primer: 1, 2, 3, 4
    • cell supernatant and infected cell supernatant: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
    • cell supernatant and MOI infection: 1, 2, 3, 4
    • cell supernatant and PCR primer: 1, 2, 3
    • embryonic fibroblast and mouse embryonic fibroblast: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21
    • forward primer sequence and PCR primer: 1, 2
    • infected cell supernatant and MOI infection: 1
    • Invitrogen Superscript III primer and PCR primer: 1