Selected article for: "infected cell and MOI infection multiplicity"

Author: Shabman, Reed S.; Shrivastava, Susmita; Tsibane, Tshidi; Attie, Oliver; Jayaprakash, Anitha; Mire, Chad E.; Dilley, Kari E.; Puri, Vinita; Stockwell, Timothy B.; Geisbert, Thomas W.; Sachidanandam, Ravi; Basler, Christopher F.
Title: Isolation and Characterization of a Novel Gammaherpesvirus from a Microbat Cell Line
  • Document date: 2016_2_17
  • ID: 1a9u53za_35
    Snippet: BGHV8 infection of cell lines. Both TCID 50 and plaque assays were used to calculate viral stock titers. BGHV8 stocks were used to infect target cells at a multiplicity of infection (MOI) of approximately 0.5 PFU/cell. Cell lines tested included mouse embryonic fibroblasts, Hepa1.6, Huh7, MRC, A549, HeLa, and Vero. Both uninfected cells and cells at days 1, 3, and 5 postinfection were collected for total RNA. Corresponding supernatant from each s.....
    Document: BGHV8 infection of cell lines. Both TCID 50 and plaque assays were used to calculate viral stock titers. BGHV8 stocks were used to infect target cells at a multiplicity of infection (MOI) of approximately 0.5 PFU/cell. Cell lines tested included mouse embryonic fibroblasts, Hepa1.6, Huh7, MRC, A549, HeLa, and Vero. Both uninfected cells and cells at days 1, 3, and 5 postinfection were collected for total RNA. Corresponding supernatant from each sample was also harvested, and DNA from supernatants was isolated (QIAamp blood kit). From total RNA, cDNA was generated using oligo(dT) primers (Superscript III; Invitrogen). Quantitative PCR primers designed against a BGHV8 capsid mRNA sequence identified in the initial RNA-seq study were used to measure BGHV8 RNA in cells. The forward primer sequence is 5= ACACCAACAGAGACCCCGCC 3=, and the reverse primer sequence is 5= AGCACGGTCTGGCTTACTTTG CG 3=. To measure particle release from infected cell supernatants, quantitative PCR from isolated DNA was performed with the same primer set.

    Search related documents:
    Co phrase search for related documents
    • approximately pfu cell and pfu cell: 1
    • blood kit and isolate dna: 1
    • blood kit and plaque assay: 1
    • blood kit and QIAamp blood kit: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11
    • blood kit and quantitative pcr: 1, 2, 3, 4