Selected article for: "copy number and mRNA expression"

Author: Mathieu, Cyrille; Guillaume, Vanessa; Sabine, Amélie; Ong, Kien Chai; Wong, Kum Thong; Legras-Lachuer, Catherine; Horvat, Branka
Title: Lethal Nipah Virus Infection Induces Rapid Overexpression of CXCL10
  • Document date: 2012_2_29
  • ID: 0d3vy87b_35
    Snippet: Reverse transcriptions were performed on 0.5 mg of total RNA using the Transcriptor first strand cDNA synthesis kit (Roche) and run in BiometraH T-GRADIENT PCR devise. Obtained cDNAs were diluted 1:10. Quantitative PCR was performed using PlatinumH SYBRH Green qPCR SuperMix-UDG with ROX kit (Invitrogen TM ). qPCR was run on the ABI 7000 PCR system (Applied biosystems) using the following protocol: 95uC 59, and 40 cycles of 95uC 150, 60uC 19, foll.....
    Document: Reverse transcriptions were performed on 0.5 mg of total RNA using the Transcriptor first strand cDNA synthesis kit (Roche) and run in BiometraH T-GRADIENT PCR devise. Obtained cDNAs were diluted 1:10. Quantitative PCR was performed using PlatinumH SYBRH Green qPCR SuperMix-UDG with ROX kit (Invitrogen TM ). qPCR was run on the ABI 7000 PCR system (Applied biosystems) using the following protocol: 95uC 59, and 40 cycles of 95uC 150, 60uC 19, followed by a melting curve up to 95uC at 0.8uC intervals. All samples were run in duplicate and results were analyzed using ABI Prism 7000 SDS software available in the genetic analysis platform (IFR128 BioSciences Lyon-Gerland). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as housekeeping gene for mRNA quantification and normalization. GAPDH and standard references for the corresponding genes were included in each run to standardize results in respect to RNA integrity, loaded quantity and inter-PCR variations. Primers used were designed using Beacon 7.0 software, and validated for their efficacy close to 100% in control PCR amplification: EFN B2 for: TCGGGCTAGTTAAGGTGTGC, EFN B2 rev: ATGAGTGTTCCATGAGTGATGC, EFN B3 for: TCACCCTCTTGGCTTCTTATCC, EFN B3 rev: GGGGA-GTGGTTGGTATGAGAG, NiV N for: GGCAGGATTCT-TCGCAACCATC, NiV N rev: GGCTCTTGGGCCAATT-TCTCTG, NiV L for: ATGGTGCTGTGCTGTCTCAGG, NiV L rev: AGCCGACATTTCTTGACAACCC, IFNß for: CTCCTAGCCTGTGCCTCTGG, IFNß rev: TGCAGTACAT-TAGCCATCAGTCAC, MxA for: AGCCACTGGACTGAC-GACTTG, MxA rev: AAATCACCACGGCTAACGGATAAG, OAS1 for: AGAACTTACCTCTTGCCAAAGG, OAS1 rev: GGACAAGGGATGTGAAAATTCC, CXCL10 for: GGAAG-GTTAATGTTCATCATCCTAAGC, CXCL10 rev: TAGTAC-CCTTGGAAGATGGGAAAG, CXCL11 for: GGATGAAAG-GTGGGTGAAAGGAC, CXCL11 rev: AACGTGAAAGCAC-TTTGTAAACTCC, GAPDH for: CACCCACTCCTCCACC-TTTGAC, GAPDH rev: GTCCACCACCCTGTTGCTGTAG. Primers used for hamster study: hamster CXCL10 for: AGA-CAACAGTAACTCCAGTGACAAG, hamster CXCL10 rev: A-GTGTAGCACCTCAGCGTAGC, murine GAPDH for: GC-ATGGCCTTCCGTGTCC, murine GAPDH rev: TGTCAT-CATACTTGGCAGGTTTCT. The relative expression represents the ratio of the number of copy of mRNA of interest versus mRNA of GAPDH and expressed in relationship to the quantity of RNA analyzed All calculations were done using the 2 DDCT model of [51] and experiments were performed according to the MIQE guideline [52] .

    Search related documents:
    Co phrase search for related documents
    • ABI Prism and duplicate run: 1
    • ABI Prism and GAPDH dehydrogenase: 1
    • ABI Prism and housekeeping gene: 1
    • ABI Prism and melt curve: 1
    • ABI Prism and mRNA quantification: 1
    • ABI Prism and PCR amplification: 1, 2, 3, 4, 5, 6
    • ABI Prism and pcr system: 1, 2, 3, 4, 5, 6
    • ABI Prism and relative expression: 1
    • ABI Prism and reverse transcription: 1, 2, 3, 4, 5, 6, 7, 8, 9
    • ABI Prism and SDS software: 1, 2, 3
    • analysis platform and GAPDH dehydrogenase: 1
    • analysis platform and genetic analysis platform: 1, 2, 3, 4, 5
    • analysis platform and PCR amplification: 1
    • analysis platform and pcr system: 1
    • analysis platform and reverse transcription: 1, 2, 3, 4, 5
    • analysis platform and RNA integrity: 1