Selected article for: "dNTPs mm and final extension"

Author: Takhampunya, Ratree; Korkusol, Achareeya; Pongpichit, Chalermpol; Yodin, Komsan; Rungrojn, Artharee; Chanarat, Nitima; Promsathaporn, Sommai; Monkanna, Taweesak; Thaloengsok, Sasikanya; Tippayachai, Bousaraporn; Kumfao, Naruemon; Richards, Allen L.; Davidson, Silas A.
Title: Metagenomic Approach to Characterizing Disease Epidemiology in a Disease-Endemic Environment in Northern Thailand
  • Document date: 2019_2_26
  • ID: 0gi6qzw0_20
    Snippet: Following DNA extraction of patient whole blood and rodent tissue, bacterial-specific 16S rDNA (V3-V4, a 550 bp fragment) was amplified in three replicates using the universal bacterial primer set; 16S amplicon PCR Forward primer (TCGTCGGCA GCGTCAGATGTGTATAAGAGACAG CCTACGGGNGGCW GCAG) and Reverse primer (GTCTCGTGGGCTCGGAG ATGTGTATAAGAGACAG GACTACHVGGGTATCTAATCC) (gene-specific sequences are underlined). PCRs were performed in a 20-µl volume cont.....
    Document: Following DNA extraction of patient whole blood and rodent tissue, bacterial-specific 16S rDNA (V3-V4, a 550 bp fragment) was amplified in three replicates using the universal bacterial primer set; 16S amplicon PCR Forward primer (TCGTCGGCA GCGTCAGATGTGTATAAGAGACAG CCTACGGGNGGCW GCAG) and Reverse primer (GTCTCGTGGGCTCGGAG ATGTGTATAAGAGACAG GACTACHVGGGTATCTAATCC) (gene-specific sequences are underlined). PCRs were performed in a 20-µl volume containing 5 µl (1-100 ng/µL) of DNA template, 400 nM each primer, 200 µM dNTPs, 1.5 mM MgCl 2 , 1× PCR buffer, and 0.4 U of iProof High-Fidelity DNA Polymerase (Bio-Rad, Hercules, CA, United States). Amplification was performed using a T100 DNA thermal cycler (Bio-Rad) under the following conditions: initial denaturation at 98 • C for 3 min; 40 cycles of 98 • C for 10 s, 60 • C for 20 s, and 72 • C for 30 s; and a final extension at 72 • C for 5 min.

    Search related documents:
    Co phrase search for related documents
    • Bio Rad thermal cycler and dna Bio Rad thermal cycler: 1
    • Bio Rad thermal cycler and dna template: 1, 2
    • Bio Rad thermal cycler and final extension: 1, 2
    • Bio Rad thermal cycler and initial denaturation: 1
    • Bio Rad thermal cycler and PCR buffer: 1
    • Bio Rad thermal cycler and PCR Forward primer: 1
    • Bio Rad thermal cycler and primer set: 1
    • Bio Rad thermal cycler and T100 dna Bio Rad thermal cycler: 1
    • Bio Rad thermal cycler and thermal cycler: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10
    • bp fragment and dna Bio Rad thermal cycler: 1
    • bp fragment and dna extraction: 1, 2, 3
    • bp fragment and dna template: 1, 2, 3, 4
    • bp fragment and final extension: 1, 2, 3
    • bp fragment and initial denaturation: 1, 2, 3
    • bp fragment and PCR buffer: 1
    • bp fragment and PCR Forward primer: 1, 2
    • bp fragment and primer set: 1
    • bp fragment and T100 dna Bio Rad thermal cycler: 1
    • bp fragment and thermal cycler: 1, 2, 3, 4, 5