Selected article for: "GAPDH expression and pcr system"

Author: Li, Zi; Lan, Yungang; Zhao, Kui; Lv, Xiaoling; Ding, Ning; Lu, Huijun; Zhang, Jing; Yue, Huiqing; Shi, Junchao; Song, Deguang; Gao, Feng; He, Wenqi
Title: miR-142-5p Disrupts Neuronal Morphogenesis Underlying Porcine Hemagglutinating Encephalomyelitis Virus Infection by Targeting Ulk1
  • Document date: 2017_5_3
  • ID: 07b3pbxc_11
    Snippet: For quantitative RT-PCR, total RNA was extracted using Trizol and miRNA was purificated by the miRNeasy Mini Kit (Qiagen, Germany), and all was quantified using a SmartSpec TM plus Spectrophotometer (BIO-RAD, USA). Reverse transcription was performed using Bulge-Loop microRNA-specific reverse transcription-primers (RiboBio, Guangzhou, China) and PrimeScript Reverse Transcriptase (Takara, Japan). Quantitative PCR reactions were conducted with SYBR.....
    Document: For quantitative RT-PCR, total RNA was extracted using Trizol and miRNA was purificated by the miRNeasy Mini Kit (Qiagen, Germany), and all was quantified using a SmartSpec TM plus Spectrophotometer (BIO-RAD, USA). Reverse transcription was performed using Bulge-Loop microRNA-specific reverse transcription-primers (RiboBio, Guangzhou, China) and PrimeScript Reverse Transcriptase (Takara, Japan). Quantitative PCR reactions were conducted with SYBR R Premix Ex Taq TM II (Takara, Japan) to analyze Ulk1 expression with GAPDH as a normalization control. MiR-142-5p level was detected using Bulge-Loop primers (RiboBio) on a CFX96 Touch TM Real-Time PCR Detection System (Bio-Rad, USA), and small nuclear RNA U6 as a normalization control. The primers for U6 and GAPDH were designed as follows: U6 sense primer, 5 ′ CTCGCT -TCGGCAGCACA 3 ′ ; U6 anti-sense primer, 5 ′ AACGCTTCACGAAYYY GCGT 3 ′ ; GAPDH sense primer, 5 ′ CTCAACTACATGGTCTACATGTTC3 ′ ; GAPDH anti-sense primer, 5 ′ ATTTGATGTTAGTGGGGTCTCGCTC3 ′ . The quantitative RT-PCR reaction conditions: pre-degeneration at 95 • C for 3 min, denaturation at 95 • C for 30 s, annealing at 60 • C for 30 s, extension at 72 • C for 30 s with a total of 40 cycles.

    Search related documents:
    Co phrase search for related documents
    • gapdh sense and RT pcr: 1
    • gapdh sense primer and RT pcr: 1