Selected article for: "Extraction kit and Gel Extraction kit"
Author: Yang, Liu; Du, Xing; Liu, Lu; Cao, Qiuyu; Pan, Zengxiang; Li, Qifa
Title: miR-1306 Mediates the Feedback Regulation of the TGF-ß/SMAD Signaling Pathway in Granulosa Cells
  • Document date: 2019_3_31
    • ID: 16qix4ab_10
    Snippet: RACE was done to obtain the full-length TGFBR2 3 -UTR according to the instructions provided in the SMARTer ® RACE 5 /3 Kit (TaKaRa, Beijing, China). We introduced a "smart oligo" at the 3 -ends of the reverse-transcribed cDNAs to prepare the 3 RACE library. The gene-specific oligonucleotide (GSP) AAGGGCGCTTTGCCGAGGTCTATAA was used to amplify the 3 -end of the TGFBR2 gene from the 3 RACE library. The products were analyzed using electrophoresis .....
    Document: RACE was done to obtain the full-length TGFBR2 3 -UTR according to the instructions provided in the SMARTer ® RACE 5 /3 Kit (TaKaRa, Beijing, China). We introduced a "smart oligo" at the 3 -ends of the reverse-transcribed cDNAs to prepare the 3 RACE library. The gene-specific oligonucleotide (GSP) AAGGGCGCTTTGCCGAGGTCTATAA was used to amplify the 3 -end of the TGFBR2 gene from the 3 RACE library. The products were analyzed using electrophoresis with 1.5% agarose gel and purified by DNA gel Extraction kit (TsingKe, Beijing, China). Purified TGFBR2 3 -UTR fragment from 3 RACE assay was cloned into the pClone007 Blunt Vector (TsingKe, Beijing, China) and verified by sequencing.

    Search related documents:
    Co phrase search for related documents
    • agarose gel and reverse transcribe: 1
    • agarose gel and sequence verify: 1
    • agarose gel electrophoresis and extraction kit: 1, 2, 3, 4, 5, 6, 7
    • agarose gel electrophoresis and sequence verify: 1
    • extraction kit and sequence verify: 1
    • extraction kit and smart oligo: 1