Author: Warner, Nikole L.; Jokinen, Jenny D.; Beier, Juliane I.; Sokoloski, Kevin J.; Lukashevich, Igor S.
Title: Mammarenaviral Infection Is Dependent on Directional Exposure to and Release from Polarized Intestinal Epithelia Document date: 2018_2_10
ID: 1t8jmunt_11
Snippet: Caco-2 cells were seeded and polarized for 21 days. Cells were infected with an MOI of 0.3 PFU/cell on either the apical, or basolateral, surface of polarized cells for all viruses. The cells were infected at 4 • C for 1 h to allow cells to attach to the cell surface, but not penetrate the cell. After the attachment period, the Input samples consisting of the cells and inoculum were directly harvested, and the experimental cells were washed sev.....
Document: Caco-2 cells were seeded and polarized for 21 days. Cells were infected with an MOI of 0.3 PFU/cell on either the apical, or basolateral, surface of polarized cells for all viruses. The cells were infected at 4 • C for 1 h to allow cells to attach to the cell surface, but not penetrate the cell. After the attachment period, the Input samples consisting of the cells and inoculum were directly harvested, and the experimental cells were washed several times with 1xPBS to remove unbound virus particles. Trizol-LS (Invitrogen) was used to harvest all of the aforementioned cells. RNA was isolated according to the manufacturer's directions. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) was used to quantitate attached viral particle. Primers and probe for ML-29/MOPV targeting the L segment: Forward (5 TCCTCAATTAGGCGTGTGAA), Reverse (5 TACACATCCTTGGGTCCTGA) and probe (5 CCCTGTTCCCTCCAACTTGTTCTTTG). Primer and probe targeting LCMV-Armstrong L segment: Forward (5 CCT TAA AGA GGT GAG AGC ATG A), reverse (5 TTTCATTGATATTCTTGGTTAGGTG) and probe (5 CAGCCACACCTGGATTCTGTAATTGG). Primer and Probe targeting LCMV-WE L segment: Forward (5 CCT GGA CTC TGT AAT TGG CA), Reverse (5 TTA CAT GCT CAG CAG CAC AG), and probe (5 TCA CAG TGG ATT TCA CAC ACA ACC AGA).
Search related documents:
Co phrase search for related documents- polarized cell and virus polarized cell: 1, 2, 3, 4, 5
- probe primer and virus particle: 1
- viral particle and virus particle: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60
Co phrase search for related documents, hyperlinks ordered by date