Novel, Divergent Simian Hemorrhagic Fever Viruses in a Wild Ugandan Red Colobus Monkey Discovered Using Direct Pyrosequencing

Lauck, Michael; Hyeroba, David; Tumukunde, Alex; Weny, Geoffrey; Lank, Simon M.; Chapman, Colin A.; O'Connor, David H.; Friedrich, Thomas C.; Goldberg, Tony L.

Once initial non-host contigs were assembled, a short sequence gap between two aligned fragments was filled by conventional PCR and Sanger sequencing. Briefly, PCR amplicons were generated with the SuperScript III One-Step RT-PCR System (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol, with specific primers designed based on pyrosequence data. Thermocycling conditions included cDNA synthesis at 50uC for 30 min and denaturation at 95uC for 2 min, followed by 40 cycles of denaturation at 94uC for 2 min, annealing at 55uC for 30 s, and extension at 68uC for 1 min. A similar sequence gap at the 39 terminal open reading frame of one contig was filled by 39 RACE according to the manufacturer's protocol (Invitrogen, Carlsbad, CA, USA). Briefly, first-strand cDNA synthesis with an oligo(dT)-containing adaptor primer was performed at 42uC for 50 min, followed by amplification of the target cDNA with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA) using a specific primer designed based on pyrosequencing data as well as the abridged universal amplification primer (AUAP) (59 GGCCAGGCGTCGACTAGTAC). Thermocycling conditions included an enzyme activation step of 3 min at 94uC followed by 35 cycles of denaturation at 94uC for 30 s, annealing at 55uC for 30 s, and extension at 72uC for 1 min. Specific primer sequences are available upon request. Amplification products were run on 1% agarose gels, purified (MinElute, Qiagen, Hilden, Germany), and directly sequenced with the DYEnamic ET Terminator Cycle Sequencing Kit (GE Healthcare, Little Chalfont, United Kingdom) on an ABI 3730 Genetic Analyzer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA).