Nonhuman Primate IFITM Proteins Are Potent Inhibitors of HIV and SIV

Wilkins, Jordan; Zheng, Yi-Min; Yu, Jingyou; Liang, Chen; Liu, Shan-Lu

Nonhuman primate IFITM genes were obtained from the following primate cell lines (Coriell Institute, Camdem, NJ): gorillia (Gorilla gorilla gorilla), L'Hoest's monkey (Cercopithecus lhoesti), moustached monkey (Cercopithecus cephus cephus), red-capped mangabey (Cercocebus torquatus torquatus), mandrill (Mandrillus sphinx), Syke's monkey (Cercopithecus albogularis), and guereza (Colobus guereza). Briefly, the total RNAs were extracted from these nonhuman primate cell lines using an RNeasy kit (Qiagen). Reverse transcription was carried out by using 1μg of total RNA, plus random primer (Thermal Fisher Scientific) and Superscript III (Invitrogen) following manufacturer's instructions. IFITM genes were PCR amplified from cDNAs using primers IFITM1 forward/reverse (CAACAGGGGAAAGCAGGGCTC/ CTGT ATCTAGGGGCAGGACCAAG) and IFITM3 forward/reverse (CAACACTTCTTTCCCC AAAGCCAG/ TTGTGGACAGGTGTGTGGG). PCR products were cloned into PCR2.1 vector, and 3-5 clones from each species were sequenced. A Flag tag was introduced to the N termini of primate IFITMs by PCR, and the insert IFITM genes in PCR2.1 were subcloned into pQCXIP vector at BamHI and EcoRI sites. All IFITM genes on pQCXIP vector were confirmed by DNA sequencing.