Selected article for: "direct sequencing and PCR sequencing"

Author: Plyusnina, Angelina; Plyusnin, Alexander
Title: Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture
  • Document date: 2005_2_22
  • ID: 04cuk2cn_17
    Snippet: A G-C A-U CCUUUAC CGGUUCA RECR855 (5'TTCTCTCCCAATTAGGTAAGCATCA3'; nt 831-855). All four primers were perfect matches to the homologous sequences; to the heterologous sequences, the forward primers have five mismatches while the reverse primers have six. Alternatively, complete S segment sequences of both variants of TULV were amplified using a single universal primer [19] and then either of the two pairs of primers was used in nested PCR. Authent.....
    Document: A G-C A-U CCUUUAC CGGUUCA RECR855 (5'TTCTCTCCCAATTAGGTAAGCATCA3'; nt 831-855). All four primers were perfect matches to the homologous sequences; to the heterologous sequences, the forward primers have five mismatches while the reverse primers have six. Alternatively, complete S segment sequences of both variants of TULV were amplified using a single universal primer [19] and then either of the two pairs of primers was used in nested PCR. Authenticity of the PCR amplicons was confirmed by direct sequencing using the ABI PRISM Dye Terminator Sequencing kit (Perkin Elmer Applied Biosystems Division).

    Search related documents:
    Co phrase search for related documents
    • direct sequencing and primer pair: 1, 2
    • direct sequencing and sequencing kit: 1
    • direct sequencing and universal primer: 1
    • forward primer and homologous sequence: 1, 2
    • forward primer and nested PCR: 1, 2
    • forward primer and PCR amplicon: 1, 2, 3, 4, 5, 6, 7
    • forward primer and primer pair: 1, 2, 3, 4, 5, 6, 7
    • forward primer and primer pair nested PCR: 1
    • forward primer and reverse primer: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81
    • forward primer and sequencing kit: 1, 2
    • forward primer and universal primer: 1, 2, 3, 4
    • heterologous sequence and homologous sequence: 1
    • homologous sequence and reverse primer: 1, 2
    • nested PCR and PCR amplicon: 1, 2, 3, 4, 5, 6, 7, 8
    • nested PCR and primer pair: 1, 2, 3, 4, 5, 6, 7, 8
    • nested PCR and primer pair nested PCR: 1, 2, 3
    • nested PCR and reverse primer: 1, 2, 3, 4, 5
    • nested PCR and sequencing kit: 1, 2, 3
    • nested PCR and universal primer: 1