Author: Atkins, John F.; Loughran, Gary; Bhatt, Pramod R.; Firth, Andrew E.; Baranov, Pavel V.
Title: Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use Document date: 2016_9_6
ID: 0s8huajd_89
Snippet: Though there is strong potential for structure formation, the sequence involved is not strongly conserved; yet the extent to which the stems are purine-rich on one strand and pyrimidine-rich on the other (the relevant sequence of Pseudomonas protegens is CTAGGCATCCGCCCCCGCAC TGACCGGGGGGCGGATGCCAAG; nucleotides with potential for stem-loop base pairing are underlined) points to the potential for triplex formation with associated relevance for diva.....
Document: Though there is strong potential for structure formation, the sequence involved is not strongly conserved; yet the extent to which the stems are purine-rich on one strand and pyrimidine-rich on the other (the relevant sequence of Pseudomonas protegens is CTAGGCATCCGCCCCCGCAC TGACCGGGGGGCGGATGCCAAG; nucleotides with potential for stem-loop base pairing are underlined) points to the potential for triplex formation with associated relevance for divalent cation binding.
Search related documents:
Co phrase search for related documents- base pair and stem loop base pair: 1, 2, 3, 4, 5, 6, 7
- base pair and triplex formation: 1
- cation binding and strong potential: 1
- involve sequence and stem loop: 1
- stem loop and structure formation: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
- stem loop and triplex formation: 1
- strong potential and structure formation: 1
- structure formation and triplex formation: 1
Co phrase search for related documents, hyperlinks ordered by date