Selected article for: "rich sequence and stem loop"

Author: Atkins, John F.; Loughran, Gary; Bhatt, Pramod R.; Firth, Andrew E.; Baranov, Pavel V.
Title: Ribosomal frameshifting and transcriptional slippage: From genetic steganography and cryptography to adventitious use
  • Document date: 2016_9_6
  • ID: 0s8huajd_89
    Snippet: Though there is strong potential for structure formation, the sequence involved is not strongly conserved; yet the extent to which the stems are purine-rich on one strand and pyrimidine-rich on the other (the relevant sequence of Pseudomonas protegens is CTAGGCATCCGCCCCCGCAC TGACCGGGGGGCGGATGCCAAG; nucleotides with potential for stem-loop base pairing are underlined) points to the potential for triplex formation with associated relevance for diva.....
    Document: Though there is strong potential for structure formation, the sequence involved is not strongly conserved; yet the extent to which the stems are purine-rich on one strand and pyrimidine-rich on the other (the relevant sequence of Pseudomonas protegens is CTAGGCATCCGCCCCCGCAC TGACCGGGGGGCGGATGCCAAG; nucleotides with potential for stem-loop base pairing are underlined) points to the potential for triplex formation with associated relevance for divalent cation binding.

    Search related documents:
    Co phrase search for related documents
    • base pair and stem loop base pair: 1, 2, 3, 4, 5, 6, 7
    • base pair and triplex formation: 1
    • cation binding and strong potential: 1
    • involve sequence and stem loop: 1
    • stem loop and structure formation: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13
    • stem loop and triplex formation: 1
    • strong potential and structure formation: 1
    • structure formation and triplex formation: 1