Author: Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico; Evans, Matthew J.
Title: Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone Document date: 2016_9_28
ID: 0i1abjfa_25
Snippet: We also generated a version of this plasmid that carries an inactivating GDD-to-GNN mutation in the viral NS5 RNA-dependent RNA polymerase (RDRP). We generated this plasmid by amplifying pCDNA6.2 MR766 Intron3127 HDVr with oligonucleotides carrying two nucleotide coding mutations in the NS5 RDRP active site as well as a silent mutation to create an SphI restriction site, ME-O-1917 (5= CTATCAT CGATTGGCTTCACAACGCAGTTATTTCCACTGACCGCC) and ME-O-1918 .....
Document: We also generated a version of this plasmid that carries an inactivating GDD-to-GNN mutation in the viral NS5 RNA-dependent RNA polymerase (RDRP). We generated this plasmid by amplifying pCDNA6.2 MR766 Intron3127 HDVr with oligonucleotides carrying two nucleotide coding mutations in the NS5 RDRP active site as well as a silent mutation to create an SphI restriction site, ME-O-1917 (5= CTATCAT CGATTGGCTTCACAACGCAGTTATTTCCACTGACCGCC) and ME-O-1918 (5= GTTGTGAAGCCAATCGATGATA GGTTTGCGCATGCCCTCAGGTTC). This PCR product was amplified with ME-O-1779 (5= GCAAGCGGCCAC GCGTCTGCACCAAAGAAGAG) and ME-O-1770 to clone into the MluI and KpnI sites. We termed this plasmid pCDNA6.2 MR766 Intron3127 Pol(Ϫ) HDVr.
Search related documents:
Co phrase search for related documents- active site and GNN gdd mutation: 1
- active site and RDRP active site: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51
- active site and RDRP RNA dependent RNA polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72
- active site and RNA dependent RNA polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73
- active site and RNA polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74
- GNN gdd and RDRP active site: 1
- GNN gdd and RDRP RNA dependent RNA polymerase: 1
- GNN gdd and RNA dependent RNA polymerase: 1
- GNN gdd and RNA polymerase: 1
- GNN gdd mutation and RDRP active site: 1
- GNN gdd mutation and RDRP RNA dependent RNA polymerase: 1
- GNN gdd mutation and RNA dependent RNA polymerase: 1
- GNN gdd mutation and RNA polymerase: 1
- PCR product and plasmid generate: 1, 2, 3
- PCR product and restriction site: 1, 2, 3, 4, 5
- PCR product and RNA polymerase: 1, 2, 3, 4
- PCR product and silent mutation: 1
- plasmid generate and restriction site: 1
- plasmid generate and RNA polymerase: 1
Co phrase search for related documents, hyperlinks ordered by date