Selected article for: "active site and viral RNA polymerase"

Author: Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico; Evans, Matthew J.
Title: Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone
  • Document date: 2016_9_28
  • ID: 0i1abjfa_25
    Snippet: We also generated a version of this plasmid that carries an inactivating GDD-to-GNN mutation in the viral NS5 RNA-dependent RNA polymerase (RDRP). We generated this plasmid by amplifying pCDNA6.2 MR766 Intron3127 HDVr with oligonucleotides carrying two nucleotide coding mutations in the NS5 RDRP active site as well as a silent mutation to create an SphI restriction site, ME-O-1917 (5= CTATCAT CGATTGGCTTCACAACGCAGTTATTTCCACTGACCGCC) and ME-O-1918 .....
    Document: We also generated a version of this plasmid that carries an inactivating GDD-to-GNN mutation in the viral NS5 RNA-dependent RNA polymerase (RDRP). We generated this plasmid by amplifying pCDNA6.2 MR766 Intron3127 HDVr with oligonucleotides carrying two nucleotide coding mutations in the NS5 RDRP active site as well as a silent mutation to create an SphI restriction site, ME-O-1917 (5= CTATCAT CGATTGGCTTCACAACGCAGTTATTTCCACTGACCGCC) and ME-O-1918 (5= GTTGTGAAGCCAATCGATGATA GGTTTGCGCATGCCCTCAGGTTC). This PCR product was amplified with ME-O-1779 (5= GCAAGCGGCCAC GCGTCTGCACCAAAGAAGAG) and ME-O-1770 to clone into the MluI and KpnI sites. We termed this plasmid pCDNA6.2 MR766 Intron3127 Pol(Ϫ) HDVr.

    Search related documents:
    Co phrase search for related documents