Selected article for: "amplified product and PCR product"
Author: Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico; Evans, Matthew J.
Title: Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone
  • Document date: 2016_9_28
    • ID: 0i1abjfa_25
    Snippet: We also generated a version of this plasmid that carries an inactivating GDD-to-GNN mutation in the viral NS5 RNA-dependent RNA polymerase (RDRP). We generated this plasmid by amplifying pCDNA6.2 MR766 Intron3127 HDVr with oligonucleotides carrying two nucleotide coding mutations in the NS5 RDRP active site as well as a silent mutation to create an SphI restriction site, ME-O-1917 (5= CTATCAT CGATTGGCTTCACAACGCAGTTATTTCCACTGACCGCC) and ME-O-1918 .....
    Document: We also generated a version of this plasmid that carries an inactivating GDD-to-GNN mutation in the viral NS5 RNA-dependent RNA polymerase (RDRP). We generated this plasmid by amplifying pCDNA6.2 MR766 Intron3127 HDVr with oligonucleotides carrying two nucleotide coding mutations in the NS5 RDRP active site as well as a silent mutation to create an SphI restriction site, ME-O-1917 (5= CTATCAT CGATTGGCTTCACAACGCAGTTATTTCCACTGACCGCC) and ME-O-1918 (5= GTTGTGAAGCCAATCGATGATA GGTTTGCGCATGCCCTCAGGTTC). This PCR product was amplified with ME-O-1779 (5= GCAAGCGGCCAC GCGTCTGCACCAAAGAAGAG) and ME-O-1770 to clone into the MluI and KpnI sites. We termed this plasmid pCDNA6.2 MR766 Intron3127 Pol(Ϫ) HDVr.

    Search related documents:
    Co phrase search for related documents
    • active site and GNN gdd mutation: 1
    • active site and RDRP active site: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • active site and RDRP RNA dependent RNA polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • active site and RNA dependent RNA polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • active site and RNA polymerase: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25
    • GNN gdd and RDRP active site: 1
    • GNN gdd and RDRP RNA dependent RNA polymerase: 1
    • GNN gdd and RNA dependent RNA polymerase: 1
    • GNN gdd and RNA polymerase: 1
    • GNN gdd mutation and RDRP active site: 1
    • GNN gdd mutation and RDRP RNA dependent RNA polymerase: 1
    • GNN gdd mutation and RNA dependent RNA polymerase: 1
    • GNN gdd mutation and RNA polymerase: 1
    • PCR product and plasmid generate: 1, 2, 3
    • PCR product and restriction site: 1, 2, 3, 4, 5
    • PCR product and RNA polymerase: 1, 2, 3, 4
    • PCR product and silent mutation: 1
    • plasmid generate and RNA polymerase: 1
    • plasmid generate and silent mutation: 1