Specific mutations in H5N1 mainly impact the magnitude and velocity of the host response in mice

Tchitchek, Nicolas; Eisfeld, Amie J; Tisoncik-Go, Jennifer; Josset, Laurence; Gralinski, Lisa E; Bécavin, Christophe; Tilton, Susan C; Webb-Robertson, Bobbie-Jo; Ferris, Martin T; Totura, Allison L; Li, Chengjun; Neumann, Gabriele; Metz, Thomas O; Smith, Richard D; Waters, Katrina M; Baric, Ralph; Kawaoka, Yoshihiro; Katze, Michael G

Quantification of influenza vRNA and mRNA transcripts was assessed using a strand-specific real-time RT-PCR method previously described [47] . Briefly, H5N1 cDNAs complementary to the two types of influenza viral RNA from the NP genomic segment were synthesized with tagged primers to add an 18-20 nucleotide tag that was unrelated to the influenza virus at the 5' end (vRNAtag; GGCCGTCATGGTGGCGAAT and mRNAtag; CCAG ATCGTTCGAGTCGT). To the mixture, 4 μl of the RNA sample was added with 1.5 μl of 10 μM primer specific for the NP genomic segment vRNA (5'-GG CCGTCATGGTGGCGAATAGCAAAAGCAGGGTAG ATAATCACTC-3') or mRNA (5'-CCAGATCGTTCGAG TCGTTTTTTTTTTTTTTTTTCTTTAATTGTC-3') and made up to 13 μl with RNase free water. The mixture was then incubated at 65°C for 5 min and was cooled to 4°C. The reaction mixture [5 μl of First Strand buffer (5×, Invitrogen, Carlsbad, CA), 4 μl of 25 mM MgCl2, 2 μl of 0.1 M dithiothreitol and 1 μl of Superscript II RT (50 U/μl, Invitrogen)] was then added. The RT reaction was carried out at 42°C for 60 min and was terminated by heating at 70°C for 5 min. After the RT reaction, SYBR-Green I real time PCR was then carried out using diluted cDNA as a template, in which 1 μl of cDNA was added to the qPCR reaction mixture [10 μl SYBR GreenERqPCRSuperMix for ABI PRISM (2×), 1.5 μl of each primer for the H5N1 NP genomic vRNA (10 μM; 5'-GGCCGTCATGGTGGCGAAT-3' and 5'-GTTCCCCA CCAGTTTCCATC-3') or mRNA (5'-CCAGATCGTTCG AGTCGT-3' and 5'-CGAACCCGATCGTGCCTTCC-3'), 3 μl of double-distilled water]. The cycle conditions of qPCR were 95°C 10 min, followed by 40 cycles of 95°C 15 s and 60°C for 1 min. H1N1 cDNA was created similarly as above with the NP genomic segment vRNAoligo listed above or mRNA-specific oligo 5'-CCAGATCGTT CGAGTCGTTTTTTTTTTTTTTTTTCAACTGTCATA CTC-3'. The genomic vRNA PCR reactions were assembled identically as above for the H5N1 virus, and mRNA reaction was assembled with the mRNA oligo tag primer 5'-CCAGATCGTTCGAGTCG-3' and H1N1specific NP mRNA primer 5'-GCTCCCCACCAGTCTCC ATT-3'. As an endogenous control, RPL10 mRNA level was measured using primers 5'-TGAAGACATGGTTG CTGAGAAG-3' and 5'-GAACGATTTGGTAGGGTAT AGGAG-3'.