Selected article for: "cell culture medium and S1 protein"

Author: Makadiya, Niraj; Brownlie, Robert; van den Hurk, Jan; Berube, Nathalie; Allan, Brenda; Gerdts, Volker; Zakhartchouk, Alexander
Title: S1 domain of the porcine epidemic diarrhea virus spike protein as a vaccine antigen
  • Document date: 2016_4_1
  • ID: 1r3doeic_33
    Snippet: Expression of recombinant S1 protein in insect cells S1 coding region of PEDV genome was PCR amplified using primers (5'-TCCGATGAATTCGCCACCATGAA GTCACTCACCTATTTTTGG-3' and 5'-CTAGATCTC GAGTCAGTGGTGATGATGGTGGTGGAAGCCAGG GAGTTCGCGG-3'). The resulting PCR product was cloned into the XhoI, EcoRI sites of pFastBac vector (ThermoFisher Scientific). Cellfectin® II Reagent (Ther-moFisher Scientific) was used for transfecting Sf9 cells in Grace's insect .....
    Document: Expression of recombinant S1 protein in insect cells S1 coding region of PEDV genome was PCR amplified using primers (5'-TCCGATGAATTCGCCACCATGAA GTCACTCACCTATTTTTGG-3' and 5'-CTAGATCTC GAGTCAGTGGTGATGATGGTGGTGGAAGCCAGG GAGTTCGCGG-3'). The resulting PCR product was cloned into the XhoI, EcoRI sites of pFastBac vector (ThermoFisher Scientific). Cellfectin® II Reagent (Ther-moFisher Scientific) was used for transfecting Sf9 cells in Grace's insect cell culture medium (ThermoFisher Scientific) for generating recombinant baculovirus. All the steps of generating the recombinant baculovirus full length genome, screening, rescue of recombinant baculovirus and large scale production of S1 protein in Sf9 cells was performed according to manufacturer's recommendations for Bac-to-Bac Baculovirus Expression System (ThermoFisher Scientific). Briefly, the Sf9 cells were grown at 30°C for 24 h in the Sf-900 II SFM (ThermoFisher Scientific) at an orbital shaker incubator in two 1 L flasks (500 mL culture volume). Sf9 cells were infected with the recombinant baculovirus at an MOI of 1 and kept for 7 days in the incubator for secretion of the recombinant S1 protein. The supernatant was collected by centrifuging the insect cells at 500 g for 5 min at room temperature.

    Search related documents:
    Co phrase search for related documents