Structure-Based Mutations in the Herpes Simplex Virus 1 Glycoprotein B Ectodomain Arm Impart a Slow-Entry Phenotype

Fan, Qing; Kopp, Sarah J.; Connolly, Sarah A.; Longnecker, Richard

To add the mutant gB 3A-encoding gene to gB-null BAC pQF282, the Kan r -encoding gene was amplified from pGS1439 by PCR with primers CGTTCCACCGGTACGGGACGACGGTAAACTGCATCGTCGA GGAGGTGGACGCGCGCTCGGTGTAGGATGACGACGATAAGTAGGGA and TCCCGTACCGGTCAACCAATTAA CCAATTCTGAT, which consist of UL27 (gB) sequence (including an AgeI restriction site [in bold]) and Kan r homology (underlined). This PCR product was digested with AgeI and ligated into AgeI-digested pSG5-HSVgB-I671A/H681A/F683A (20) to generate pQF270. pSG5-HSVgB-I671A/H681A/F683A is a plasmid that carries the gB 3A mutant gene and contains a unique AgeI site located in the middle of the gB-encoding gene. The gB 3A-encoding gene containing a Kan r -encoding gene insert was amplified from pQF270 by PCR with primers ACAAACCAAAAGATGCACATGCGGTTTAACACCCGTGGTTTTTATTTACAACAA ACCCCCCGTCACAGGTCGTCCTCGTCGGCGTC and CCTCCAGCACCTCGCCCCCAGGCTACCTGACGGGGGGC ACGACGGGCCCCCGTAGTCCCGCCATGCACCAGGGCGCCCCCTCGTGG. By two-step red-mediated recombination, this PCR product was recombined into gB-null BAC pQF282 and then the Kan r cassette was recombined out to generate BAC pQF297, which carries the gB 3A mutant gene in place of WT gB (Fig. 1D) . At each step of the BAC constructions, the intermediate BACs with Kan r -encoding gene insertions and the final BACs were confirmed by at least four restriction enzyme digestions.