Author: Fan, Qing; Kopp, Sarah J.; Connolly, Sarah A.; Longnecker, Richard
Title: Structure-Based Mutations in the Herpes Simplex Virus 1 Glycoprotein B Ectodomain Arm Impart a Slow-Entry Phenotype Document date: 2017_5_16
ID: 1v6nf28a_28
Snippet: Virus construction. To construct the HSV-1 gB 3A viruses, we first created a gB-null virus by using BAC pGS3217 (kindly provided by Gregory Smith, Northwestern University). GS3217 is an HSV-1 F strain that carries the red fluorescent protein (RFP) tdTomato reporter gene with a nuclear localization signal under the control of a cytomegalovirus (CMV) promoter. GS3217 was derived from a BAC kindly provided by Yasushi Kawaguchi, University of Tokyo (.....
Document: Virus construction. To construct the HSV-1 gB 3A viruses, we first created a gB-null virus by using BAC pGS3217 (kindly provided by Gregory Smith, Northwestern University). GS3217 is an HSV-1 F strain that carries the red fluorescent protein (RFP) tdTomato reporter gene with a nuclear localization signal under the control of a cytomegalovirus (CMV) promoter. GS3217 was derived from a BAC kindly provided by Yasushi Kawaguchi, University of Tokyo (51) . The CMVϾNLS-tdTomatoϾpA cassette is inserted after the start codon of US5 (gJ) and introduces an in-frame stop codon. First, the Kan r -encoding gene was amplified from pGS1439 by PCR with primers TGCACATGCGGTTTAACACCCGTGGTTTTTATTTACAACAAA CCCCCCGGGCGGGACTACGGGGAGGATGACGACGATAAGTAGGG and GCCCCCAGGCTACCTGACGGGGG GCACGACGGGCCCCCGTAGTCCCGCCCGGGGGGTTTGTTGTCAACCAATTAACCAATTCTGAT, which consist of UL27 (gB) flanking sequence and Kan r homology (in bold). By using a two-step red-mediated recombination strategy (32, 33) , this PCR product was recombined into pGS3217 in place of UL27 (gB) to delete WT UL27 and then the Kan r cassette was recombined out to generate gB-null BAC pQF282 ( Fig. 1B and C) .
Search related documents:
Co phrase search for related documents- CMV promoter and cytomegalovirus CMV promoter control: 1, 2, 3, 4, 5, 6
- CMV promoter and nuclear localization: 1
- CMV promoter and nuclear localization signal: 1
- frame stop and PCR product: 1, 2
- gB null and PCR product: 1
- nuclear localization and PCR product: 1
- nuclear localization signal and PCR product: 1
Co phrase search for related documents, hyperlinks ordered by date