Selected article for: "master mix and quantitative pcr"

Author: Claus, Claudia; Manssen, Lena; Hübner, Denise; Roßmark, Sarah; Bothe, Viktoria; Petzold, Alice; Große, Claudia; Reins, Mareen; Mankertz, Annette; Frey, Teryl K.; Liebert, Uwe G.
Title: Activation of the Mitochondrial Apoptotic Signaling Platform during Rubella Virus Infection
  • Document date: 2015_11_26
  • ID: 1rrm4sqa_63
    Snippet: Total RNA was extracted and reverse transcribed and analyzed by quantitative real-time PCR as published [25] . Reactions were performed in a total of 20 µL containing 10 µL GoTaq qPCR (2¢) Master Mix (Promega, Mannheim, Germany) and 1 µg BSA. According to reference sequence NM_005038 primer sequences were selected for Cyp40, 5 I tgaaaggtgaaaaacctgctaaa 3 I for the sense primer CyP40.s, and 5 I cagagccatcttttgggaata 3 I for the antisense prime.....
    Document: Total RNA was extracted and reverse transcribed and analyzed by quantitative real-time PCR as published [25] . Reactions were performed in a total of 20 µL containing 10 µL GoTaq qPCR (2¢) Master Mix (Promega, Mannheim, Germany) and 1 µg BSA. According to reference sequence NM_005038 primer sequences were selected for Cyp40, 5 I tgaaaggtgaaaaacctgctaaa 3 I for the sense primer CyP40.s, and 5 I cagagccatcttttgggaata 3 I for the antisense primer CyP40.as. An amplicon of 96 bp was generated. The p21 primer sequences are as published [25] .

    Search related documents:
    Co phrase search for related documents
    • primer sequence and reference sequence: 1, 2, 3, 4
    • quantitative real time PCR analyze and real time: 1, 2, 3, 4, 5, 6
    • real time and reference sequence: 1, 2, 3, 4, 5, 6, 7, 8, 9
    Co phrase search for related documents, hyperlinks ordered by date