Selected article for: "random hexamer and RNA template"

Author: Schwarz, Megan C.; Sourisseau, Marion; Espino, Michael M.; Gray, Essanna S.; Chambers, Matthew T.; Tortorella, Domenico; Evans, Matthew J.
Title: Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone
  • Document date: 2016_9_28
  • ID: 0i1abjfa_30
    Snippet: RT-PCR analysis of splicing. RNA was extracted from cells 48 h after transfection with the wild-type MR766 plasmid or Pol(Ϫ) plasmid or infection with the parental MR766 virus or a mock control using the PureLink RNA minikit (Thermo Fisher Scientific, Waltham, MA). The extracted RNA was used as a template for random hexamer-primed cDNA synthesis using the SuperScript III First-Strand synthesis system (Thermo Fisher Scientific, Waltham, MA). Five.....
    Document: RT-PCR analysis of splicing. RNA was extracted from cells 48 h after transfection with the wild-type MR766 plasmid or Pol(Ϫ) plasmid or infection with the parental MR766 virus or a mock control using the PureLink RNA minikit (Thermo Fisher Scientific, Waltham, MA). The extracted RNA was used as a template for random hexamer-primed cDNA synthesis using the SuperScript III First-Strand synthesis system (Thermo Fisher Scientific, Waltham, MA). Five hundred nanograms of cDNA was used for PCR using the Expand High-Fidelity PCR system (Roche Life Sciences, Indianapolis, IN) with oligonucleotides flanking the region into which the intron was cloned: ME-O-1722 (ATGTCCGCTTGAGCACAGAG) and ME-O-1738 (AGCGATGTTGTCAGTGCGTG). PCR products were ligated into pGEM-T vector (Promega, Madison, WI) for subsequent propagation in bacteria and sequencing.

    Search related documents:
    Co phrase search for related documents
    • cdna synthesis and PCR product: 1, 2, 3, 4, 5, 6, 7
    • cdna synthesis and pcr system: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14
    • cdna synthesis and RT PCR analysis: 1, 2, 3, 4, 5, 6
    • cell extract and RNA cell extract: 1, 2, 3, 4
    • cell extract and RT PCR analysis: 1, 2
    • High fidelity and mock control: 1
    • High fidelity and PCR product: 1
    • High fidelity and pcr system: 1, 2, 3, 4, 5, 6, 7, 8
    • High fidelity pcr system and pcr system: 1, 2, 3, 4, 5, 6, 7
    • mock control and pcr system: 1
    • PCR product and RT PCR analysis: 1, 2, 3, 4, 5
    • pcr system and rna minikit: 1
    • pcr system and RT PCR analysis: 1, 2, 3, 4, 5, 6, 7, 8