Selected article for: "suilysin deficient mutant and suis wt"

Author: Meng, Fandan; Wu, Nai-Huei; Seitz, Maren; Herrler, Georg; Valentin-Weigand, Peter
Title: Efficient suilysin-mediated invasion and apoptosis in porcine respiratory epithelial cells after streptococcal infection under air-liquid interface conditions
  • Document date: 2016_5_27
  • ID: 0jsc81sy_32
    Snippet: S. suis strain 10cS148Δ sly (designated cS148) and 10cW461FΔ sly (designated cW461F) were constructed by chromosomal complementation of the S. suis suilysin-deficient mutant 10Δ sly by allelic exchange. The amplicon slyBamHI_SphI_cS148 was generated using oligonucleotide primers PM_sly_SphIfor (CCCGCATGCATGAGAAAAAGTTCGCACTT) and PM_sly_BamHIrev (CCCGGATCCTTACTCTATCACCTCATCCG). The amplicon slyBamHI_SphI_cW461Fmax was generated with oligonucleo.....
    Document: S. suis strain 10cS148Δ sly (designated cS148) and 10cW461FΔ sly (designated cW461F) were constructed by chromosomal complementation of the S. suis suilysin-deficient mutant 10Δ sly by allelic exchange. The amplicon slyBamHI_SphI_cS148 was generated using oligonucleotide primers PM_sly_SphIfor (CCCGCATGCATGAGAAAAAGTTCGCACTT) and PM_sly_BamHIrev (CCCGGATCCTTACTCTATCACCTCATCCG). The amplicon slyBamHI_SphI_cW461Fmax was generated with oligonucleotide primers sly_pSET5s_SphIfor (CCCGCATGCAGTATAATACATTGCCAGAT) and sly_pSET5s_ BamHIrev (CCCGGATCCTATTCCGGAAATTGTTGGAA). DNA of S. suis wt 10 was used as template. The amplicons were cut with the restriction enzymes indicated in the name of the primers and inserted into the corresponding sites of pSET5s vector 55 . Oligonucleotide primers SLYcompSMfor (ATTCTCCAACAAGATCAACTGTTCGAACAGG) and SLYcompSMrev (CCTGTTCGAACAGTTGATCTTGTTGGAGAAT) encoding the silent mutation S148 in the suilysin gene and oligonucleotide primers slyTrp-Phefornew (TACAGGATTAGCATTTGAGTGGTGGAGAAC) and slyTrp-Pherevnew (GTTCTCCACCACTCAAATGCTAATCCTGTAC) encoding the W461 to F461 substitution were used to generate point-mutations by site-directed-mutagenesis according to the instruction manual of QuikChange ® Site-Directed Mutagenesis Kit (Stratagene, Ja Jolla, CA). Restriction analysis and sequencing was performed with pSET5s_sly_S148 and pSET5s_sly_W461F, respectively, to verify both constructs. The allelic exchanges for generation of 10cS148Δ sly (cS148) and 10cW461FΔ sly (cW461F) were performed essentially as described previously 56 . Final sequencing was performed to verify the resulting S. suis strains cS148 and cW461F, respectively.

    Search related documents:
    Co phrase search for related documents
    • restriction analysis and silent mutation: 1
    • restriction enzyme and sequencing restriction analysis: 1, 2
    • restriction enzyme and silent mutation: 1
    • result suis and suis wt: 1
    • sequencing restriction analysis and silent mutation: 1