Selected article for: "forward primer and reverse forward primer"

Author: Lv, Lishan; Li, Xiaoming; Liu, Genmei; Li, Ran; Liu, Qiliang; Shen, Huifang; Wang, Wei; Xue, Chunyi; Cao, Yongchang
Title: Production and immunogenicity of chimeric virus-like particles containing the spike glycoprotein of infectious bronchitis virus
  • Document date: 2014_6_16
  • ID: k785hl1r_7
    Snippet: Briefly, the genes encoding NA and M1 proteins of influenza virus A/GOOSE/GD/96 (H5N1; Access No. NC_007363) and S1 protein of IBV H120 were first obtained by RT-PCR (PrimeScripTM 1st Strand cDNA Synthesis Kit, Takara Bio, China) and then cloned into pMD-18T vector to obtain recombinant plasmids pMD-18T-NA, pMD-18T-M1 and pMD-18T-S1. NA/S1 fusion gene was then generated by overlap PCR. The full-length of the fusion gene was 1674 bp, and it contai.....
    Document: Briefly, the genes encoding NA and M1 proteins of influenza virus A/GOOSE/GD/96 (H5N1; Access No. NC_007363) and S1 protein of IBV H120 were first obtained by RT-PCR (PrimeScripTM 1st Strand cDNA Synthesis Kit, Takara Bio, China) and then cloned into pMD-18T vector to obtain recombinant plasmids pMD-18T-NA, pMD-18T-M1 and pMD-18T-S1. NA/S1 fusion gene was then generated by overlap PCR. The full-length of the fusion gene was 1674 bp, and it contained the CT and TM domains of NA (1∼120 bp) and the S1 sequence (121∼1,674 bp) [3] . The specific primers used to amplify the CT and TM domain were CCGGAATTCATGAATCCAAATCAGAA (forward primer 1) and GACCCATATTGAGATTAGTTTTGTATG (reverse primer 1). The primers used to generate S1 were CAATAT GGGTCATGTCGTACTACCATC (forward primer 2) and ACGCGTCGACACGTCTAAAACGACGTGTT (reverse primer 2). The above two PCR products were mixed equally to generate the fusion gene NA/S1 by PCR using forward primer 1 and reverse primer 2. The nucleotide sequences of the NA/S1 fusion and M1 genes were confirmed by DNA sequencing and then cloned into pFast-Bac-Dual vector (Invitrogen, USA) [26] . Recombinant bacmids r-Bacmid-NA/S1 and r-Bacmid-M1 were generated by transforming the recombinant pFast-Bac-Dual vector into Escherichia coli DH10-Bac competent cells. The purified recombinant bacmid DNA was then transfected into sf9 cells with cellfectin reagent (Invitrogen). After 3 days, the recombinant baculoviruses (rBV-NA/S1 and rBV-M1) were obtained from the supernatant and subjected to three rounds of plaque purification.

    Search related documents:
    Co phrase search for related documents
    • cellfectin reagent and recombinant plasmid: 1
    • competent cell and influenza virus: 1, 2
    • competent cell and nucleotide sequence: 1
    • competent cell and PCR product: 1