Selected article for: "PCR primer and primer reverse"

Author: Liu, Zhida; Zhou, Hang; Wang, Wenjun; Tan, Wenjie; Fu, Yang-Xin; Zhu, Mingzhao
Title: A novel method for synthetic vaccine construction based on protein assembly
  • Document date: 2014_12_1
  • ID: 2tazu4y6_19
    Snippet: Cloning, expression, and purification of fusion proteins. The full-length SpyCatcher expression plasmid pDEST14-SpyCatcher was kindly provided by Dr. Mark Howarth (University of Oxford, UK). DNA sequences of truncated forms of SpyCatcher were first amplified by PCR using the following primers: common forward primer DSc-F1 (GATTACGACATCCCAACGACCGAAAACCTGTAT-TTTCAGGGCGATAGTGCTAC) and reverse primers DSc-R1 (CGCGGA-TCCTTAAT TAACTGTAAAGGTAATAGCAGTTGC.....
    Document: Cloning, expression, and purification of fusion proteins. The full-length SpyCatcher expression plasmid pDEST14-SpyCatcher was kindly provided by Dr. Mark Howarth (University of Oxford, UK). DNA sequences of truncated forms of SpyCatcher were first amplified by PCR using the following primers: common forward primer DSc-F1 (GATTACGACATCCCAACGACCGAAAACCTGTAT-TTTCAGGGCGATAGTGCTAC) and reverse primers DSc-R1 (CGCGGA-TCCTTAAT TAACTGTAAAGGTAATAGCAGTTGCT, for SpyCatcherDN) and DSc-R2 (CGCGGATCCTTAAATATGAGCGTCACCTTTAGTTGCTTT, for SpyCatcherDNC). A 63-histidine tag coding sequence was further added by secondary PCR using DSc-F2 (GGAATTCCATATGTCGTACTACCATCACC ATCACCATCACGATTACGACATCCCAA) and DSc-R1 or DSc-R2. The bold font indicates an NdeI or BamHI site. The underlined letters encode a tobacco etch virus (TEV) protease cleavage site or 63-histidine tag. The PCR products were cloned into pDEST14 using the NdeI and BamHI sites.

    Search related documents:
    Co phrase search for related documents