Capturing diverse microbial sequence with comprehensive and scalable probe design

Hayden C. Metsky; Katherine J. Siddle; Adrianne Gladden-Young; James Qu; David K. Yang; Patrick Brehio; Andrew Goldfarb; Anne Piantadosi; Shirlee Wohl; Amber Carter; Aaron E. Lin; Kayla G. Barnes; Damien C. Tully; Björn Corleis; Scott Hennigan; Giselle Barbosa-Lima; Yasmine R. Vieira; Lauren M. Paul; Amanda L. Tan; Kimberly F. Garcia; Leda A. Parham; Ikponmwonsa Odia; Philomena Eromon; Onikepe A. Folarin; Augustine Goba; Etienne Simon-Lorière; Lisa Hensley; Angel Balmaseda; Eva Harris; Douglas Kwon; Todd M. Allen; Jonathan A. Runstadler; Sandra Smole; Fernando A. Bozza; Thiago M. L. Souza; Sharon Isern; Scott F. Michael; Ivette Lorenzana; Lee Gehrke; Irene Bosch; Gregory Ebel; Donald Grant; Christian Happi; Daniel J. Park; Andreas Gnirke; Pardis C. Sabeti; Christian B. Matranga

We prepared the focused probe sets (V WAFR , V MM , V ZC ) using a traditional probe production approach 82 in which DNA oligos were synthesized on a 12k or 90k array (CustomArray). To minimize PCR amplification bias and formation of concatemers by overlap extension we performed two separate emulsion PCR reactions (Micellula, Chimerx) to amplify the nonoverlapping probe subsets (assigned adapters A and B as described above). One primer in each reaction carried a T7 promoter tail (GGATTCTAATACGACTCACTATAGGG) at the 5' end. We performed in vitro transcription (MEGAshortscript, Ambion) on each of these pools to produce biotinylated capture-ready RNA probes. Pools were aliquoted and stored at −80 • C and combined at equal concentration and volume immediately prior to use. Hybrid capture was a modification of a published protocol 82 . Briefly, we mixed the probes, salmon sperm DNA and human Cot-1 DNA, adapter blocking oligonucleotides and libraries and hybridized overnight (∼ 16 hrs), captured on streptavidin beads, washed, and re-amplified by PCR (16-18 cycles). PCR primers and index blockers were the same as those used in the protocol for the V ALL probe set. In some cases, we changed the Nextera XT indexes during final PCR amplification to enable sequencing of pre-and post-capture samples on the same run.