A novel method for synthetic vaccine construction based on protein assembly

Liu, Zhida; Zhou, Hang; Wang, Wenjun; Tan, Wenjie; Fu, Yang-Xin; Zhu, Mingzhao

To generate a SpyCatcherDN-OVA 8 -TBEV ED3 expression plasmid, cDNA encoding TBEV ED3 was PCR amplified with the plasmid pET-30a(1)-TBEV ED3, provided by Dr. Xiaoping Kang (Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, China), and G 4 S linker and the OVA 8 epitope (chicken ovalbumin 257-264 , or SIINFEKL) were added at the N-terminus during PCR. The primers used in the PCR were as follows: OE F (CCGCTCGAGGGCGGTG-GTGGCAGCCAGCTTGAGAGTATAATCAACTTTGAAAAAC TGACTG-AATGGACATAC ACAATGTGCG) and OE R (CCGCGAGCTCTTATCA TTTTTGGAACCATTG), in which the bold font indicates an XhoI or SacI site. The SpyCatcherDN fragment was amplified using the primers DNSc-F (GCAATTCCATATGTC GTACTACCATCAC) and DNSc-R (CCGCTCGAGAATATGAGCGTCACCTTTA G), in which the bold font indicates an NdeI or XhoI site. The SpyCatcherDN and OVA 8 -TBEV ED3 fragments were then ligated and cloned into pDEST14 at the NdeI and SacI sites. Expression and purification of the SpyCatcherDN-OVA 8 -TBEV ED3 protein were performed as described above.